Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35846
Trapped Gene
Rab2b (ENSMUSG00000022159)
Vector Insertion
Chr 14: 52888592 - 52895186
Public Clones IST10825G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124065 (Chr14:52895118..52895185 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTCAACATCGATGGAAAA Chr14:52895145..52895164 59.9 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124065 (Chr14:52895118..52895185 -)
Downstram Exon
ENSMUSE00000124064 (Chr14:52888593..52888675 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTCAACATCGATGGAAAA Chr14:52895145..52895164 59.9 40 GCTGCTCCCCTGTAGTAGGA Chr14:52888601..52888620 59.45 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000649025 Chr14:52898871..52899012 No primer for this exon
upstream ENSMUSE00000124067 Chr14:52898589..52898660 CGTGCACGACCTCACAATAG Chr14:52898589..52898608 60.32 55
upstream ENSMUSE00000124065 Chr14:52895118..52895185 TGGTCAACATCGATGGAAAA Chr14:52895145..52895164 59.9 40
upstream ENSMUSE00000124064 Chr14:52888593..52888675 TTCCGTTCTATCACCCGTTC Chr14:52888641..52888660 59.93 50

*** Putative Vector Insertion (Chr 14: 52888592 - 52895186) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124068 Chr14:52888317..52888409 GCGTCCTCTAACCATGAGGT Chr14:52888346..52888365 59.17 55
downstream ENSMUSE00000124070 Chr14:52885865..52885976 GGCTGTCTTGGCTGATGTTT Chr14:52885858..52885877 60.26 50
downstream ENSMUSE00000124066 Chr14:52884374..52884442 No primer for this exon
downstream ENSMUSE00000124069 Chr14:52881446..52883492 TCAGCCTAAGCAACGAGGAT Chr14:52883270..52883289 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTGGTTTTCCACATTGGTG Chr14:52889193..52889214 59.7 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTGGTTTTCCACATTGGTG Chr14:52889193..52889214 59.7 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022159