Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3589
Trapped Gene
Sfrs3 (ENSMUSG00000071172)
Vector Insertion
Chr 17: 29169732 - 29173185
Public Clones (sanger) (sanger) BC0137 (sanger) CSI776 (baygenomics) RRM049 (baygenomics)
P117B09 (ggtc) P133D07 (ggtc) P116G04 (ggtc) P150C09 (ggtc) P117B09 (ggtc)
Q998A02 (ggtc) P012H08 (ggtc) P150C08 (ggtc) P150C09 (ggtc) (ggtc)
P117B09 (ggtc) P150C09 (ggtc) PST15383-NR (escells) PST6561-NR (escells)
PST17067-NR (escells) PST14120-NR (escells) PST2290-NR (escells) PST24753-NR (escells)
PST10958-NR (escells) PST22490-NR (escells) PST8869-NR (escells) PST4309-NR (escells)
PST16715-NR (escells) PST9888-NR (escells) PST4305-NR (escells) PST23229-NR (escells)
PST3166-NR (escells) PST17585-NR (escells) PST2681-NR (escells) PST6150-NR (escells)
PST9814-NR (escells) PST22660-NR (escells) IST14710B5 (tigm)
Private Clones OST332228 (lexicon) OST114734 (lexicon) OST111709 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657877 (Chr17:29169618..29169731 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCGGAGCGTTAGGATTTGA Chr17:29169684..29169703 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657877 (Chr17:29169618..29169731 +)
Downstram Exon
ENSMUSE00000238003 (Chr17:29173186..29173393 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCGGAGCGTTAGGATTTGA Chr17:29169684..29169703 60.21 50 AAGGGACAGGAATCACGATG Chr17:29173213..29173232 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657877 Chr17:29169618..29169731 GTCGGAGCGTTAGGATTTGA Chr17:29169684..29169703 60.21 50

*** Putative Vector Insertion (Chr 17: 29169732 - 29173185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238003 Chr17:29173186..29173393 AAGGGACAGGAATCACGATG Chr17:29173213..29173232 59.93 50
downstream ENSMUSE00000657876 Chr17:29175435..29175569 AGGACTCCTCCTGCGGTAAT Chr17:29175558..29175577 60.1 55
downstream ENSMUSE00000700347 Chr17:29176399..29176432 GGGTGGTGAGAAGAGACATGA Chr17:29176429..29176449 60.1 52.38
downstream ENSMUSE00000657875 Chr17:29177720..29177758 No primer for this exon
downstream ENSMUSE00000657874 Chr17:29178152..29178238 GATCGAGACGGCTTGTGATT Chr17:29178223..29178242 60.23 50
downstream ENSMUSE00000609803 Chr17:29178329..29179039 TGCATCCCCATAGAGAAACC Chr17:29178874..29178893 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCGGAGCGTTAGGATTTGA Chr17:29169685..29169705 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCGGAGCGTTAGGATTTGA Chr17:29169685..29169705 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071172