Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35890
Trapped Gene
D430041B17Rik (ENSMUSG00000053550)
Vector Insertion
Chr 7: 4785831 - 4787777
Public Clones IST12581A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711337 (Chr7:4787646..4787776 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711337 (Chr7:4787646..4787776 -)
Downstram Exon
ENSMUSE00000538435 (Chr7:4785832..4785986 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50 TGGGGTCAGAGAACTGCTTC Chr7:4785886..4785905 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711337 Chr7:4787646..4787776 TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50
upstream ENSMUSE00000716075 Chr7:4787646..4787857 TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50
upstream ENSMUSE00000721807 Chr7:4787646..4787776 TGTGCGGAGTCATCAGTTTC Chr7:4787732..4787751 59.84 50
upstream ENSMUSE00000538435 Chr7:4785832..4785986 CAAGGACACCCAAGAACCTT Chr7:4785860..4785879 59.04 50
upstream ENSMUSE00000718468 Chr7:4785832..4785986 CAAGGACACCCAAGAACCTT Chr7:4785860..4785879 59.04 50

*** Putative Vector Insertion (Chr 7: 4785831 - 4787777) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000417222 Chr7:4783275..4783325 GCTGTTGACGTTGTAGTGCAG Chr7:4783278..4783298 59.57 52.38
downstream ENSMUSE00000417217 Chr7:4782361..4782510 ATCGGGAGCAGGATAGTGTG Chr7:4782426..4782445 60.1 55
downstream ENSMUSE00000417238 Chr7:4780076..4781877 GGCTACACATGCCCAACTTT Chr7:4780276..4780295 60 50
downstream ENSMUSE00000713592 Chr7:4779629..4781877 GGTCACGCAAAGAAAGAAGC Chr7:4780019..4780038 60 50
downstream ENSMUSE00000721749 Chr7:4777154..4781877 GGTCACGCAAAGAAAGAAGC Chr7:4780019..4780038 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCAGTTTCGCCCTAATCG Chr7:4787720..4787740 60.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGCGGAGTCATCAGTTTC Chr7:4787730..4787750 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053550