Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35901
Trapped Gene
Pde11a (ENSMUSG00000075270)
Vector Insertion
Chr 2: 76129221 - 76176711
Public Clones IST11816A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714318 (Chr2:76175753..76176710 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCAAGAAGACGTTGGTCTC Chr2:76175901..76175920 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714318 (Chr2:76175753..76176710 -)
Downstram Exon
ENSMUSE00000644389 (Chr2:76129222..76129380 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCAAGAAGACGTTGGTCTC Chr2:76175901..76175920 59.85 55 GCACCCTCAGGGACCTTATT Chr2:76129225..76129244 60.33 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714318 Chr2:76175753..76176710 GGCAAGAAGACGTTGGTCTC Chr2:76175901..76175920 59.85 55
upstream ENSMUSE00000718422 Chr2:76175753..76176710 GGCAAGAAGACGTTGGTCTC Chr2:76175901..76175920 59.85 55
upstream ENSMUSE00000644389 Chr2:76129222..76129380 GCCCAGGCGATAAATAAGGT Chr2:76129259..76129278 60.3 50
upstream ENSMUSE00000689844 Chr2:76129222..76129380 GCCCAGGCGATAAATAAGGT Chr2:76129259..76129278 60.3 50

*** Putative Vector Insertion (Chr 2: 76129221 - 76176711) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000689843 Chr2:76053375..76053464 CGATTCCACAGAACGGAAGA Chr2:76053409..76053428 61.18 50
downstream ENSMUSE00000689855 Chr2:76053375..76053464 CGATTCCACAGAACGGAAGA Chr2:76053409..76053428 61.18 50
downstream ENSMUSE00000644386 Chr2:76049080..76049220 ACGGAACAGCGTTCACATTT Chr2:76049086..76049105 60.56 45
downstream ENSMUSE00000689854 Chr2:76032946..76033010 TGGGGACATCAGTTCAAAGG Chr2:76032950..76032969 60.89 50
downstream ENSMUSE00000689853 Chr2:75996353..75996485 TAGGCATCGCTGACATTCAC Chr2:75996356..75996375 59.83 50
downstream ENSMUSE00000644380 Chr2:75977892..75977967 GTTCCAAATGGGGACACAGA Chr2:75977889..75977908 60.76 50
downstream ENSMUSE00000644379 Chr2:75975396..75975463 TCAAAAGGTTTTCCGTCGAG Chr2:75975399..75975418 60.22 45
downstream ENSMUSE00000644378 Chr2:75974424..75974516 CCAAGGCCACAAAAGATGAC Chr2:75974469..75974488 60.49 50
downstream ENSMUSE00000644377 Chr2:75951561..75951611 GTCGACTTCAGCCTTGGAAC Chr2:75951548..75951567 59.85 55
downstream ENSMUSE00000644374 Chr2:75913994..75914140 GGGAAAAGTCATCGAAATGG Chr2:75914055..75914074 59.36 45
downstream ENSMUSE00000644373 Chr2:75913410..75913517 ATCAGTTGGCACACGTTGAA Chr2:75913404..75913423 60.16 45
downstream ENSMUSE00000644372 Chr2:75897033..75897142 TTTCCACCTCGGTCAGAATC Chr2:75897084..75897103 60.05 50
downstream ENSMUSE00000644371 Chr2:75888197..75888287 AATGGTGATGCTCCAAGGTC Chr2:75888207..75888226 59.93 50
downstream ENSMUSE00000644370 Chr2:75884836..75884936 GCGTGAGGTCTGTGGCTAAT Chr2:75884824..75884843 60.28 55
downstream ENSMUSE00000689850 Chr2:75868981..75869058 ACATCTCGGTGGCTTGTGAT Chr2:75868965..75868984 60.54 50
downstream ENSMUSE00000644366 Chr2:75867334..75867397 CAAGGTCACAGGCTGTCATT Chr2:75867347..75867366 58.72 50
downstream ENSMUSE00000689842 Chr2:75865884..75865907 CTATGGCAGCAATCCTCCAG Chr2:75865862..75865881 60.76 55
downstream ENSMUSE00000644365 Chr2:75860768..75860842 CCTCTCCCGATCTCCTTGTT Chr2:75860770..75860789 60.59 55
downstream ENSMUSE00000644364 Chr2:75855893..75855976 GCAGTTCATCTTTCCGGTTC Chr2:75855921..75855940 59.68 50
downstream ENSMUSE00000689847 Chr2:75844039..75844098 ACATCGGAAATAAGGGCTGA Chr2:75844023..75844042 59.53 45
downstream ENSMUSE00000644363 Chr2:75829189..75829344 TTTGCATTGACCTTCACCAA Chr2:75829300..75829319 60.09 40
downstream ENSMUSE00000689846 Chr2:75828779..75829344 TTTGCATTGACCTTCACCAA Chr2:75829300..75829319 60.09 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGGAGAGAGAAATGGAGA Chr2:76170725..76170745 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGGAGAGAGAAATGGAGA Chr2:76170725..76170745 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075270