Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35923
Trapped Gene
Ssxb9 (ENSMUSG00000068218)
Vector Insertion
Chr X: 7952517 - 7999106
Public Clones IST12744A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660989 (ChrX:7952337..7952516 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGTGGCAATTCAACATT ChrX:7952369..7952388 58.98 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660989 (ChrX:7952337..7952516 +)
Downstram Exon
ENSMUSE00000711504 (ChrX:7999107..7999284 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGTGGCAATTCAACATT ChrX:7952369..7952388 58.98 40 TTCTTCCACTGTGGGCTCAT ChrX:7999138..7999157 60.66 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000624944 ChrX:7944104..7944227 No primer for this exon
upstream ENSMUSE00000624943 ChrX:7946668..7946794 GTCCCCATGGAAGTGCTTTA ChrX:7946753..7946772 59.93 50
upstream ENSMUSE00000714482 ChrX:7946668..7946794 GTCCCCATGGAAGTGCTTTA ChrX:7946753..7946772 59.93 50
upstream ENSMUSE00000624942 ChrX:7947248..7947362 GGCAGAAAAGTGCCTACGTG ChrX:7947306..7947325 60.83 55
upstream ENSMUSE00000624941 ChrX:7947662..7947751 CCGTGAACCAACCAGTTTTC ChrX:7947668..7947687 60.39 50
upstream ENSMUSE00000624940 ChrX:7948227..7948276 GTGTGACACCGAGAAAACGA ChrX:7948251..7948270 59.73 50
upstream ENSMUSE00000624938 ChrX:7948889..7948964 GGAAGCCTTGCCTCTGTAAA ChrX:7948925..7948944 59.45 50
upstream ENSMUSE00000624937 ChrX:7951816..7951932 CTAGTGGCATTCGGGTCAAT ChrX:7951819..7951838 59.96 50
upstream ENSMUSE00000660989 ChrX:7952337..7952516 TGGAGTGGCAATTCAACATT ChrX:7952369..7952388 58.98 40

*** Putative Vector Insertion (Chr X: 7952517 - 7999106) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711504 ChrX:7999107..7999284 TTCTTCCACTGTGGGCTCAT ChrX:7999138..7999157 60.66 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAAACTAATCGCCTTGCAG ChrX:7979562..7979582 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAACCGTGACTGGGAAAACC ChrX:7961564..7961584 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068218