Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35925
Trapped Gene
Zfp825 (ENSMUSG00000069208)
Vector Insertion
Chr 13: 74620264 - 74631419
Public Clones (sanger) 5SD054G06 (ggtc) 3SD054G06 (ggtc) IST15069B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681031 (Chr13:74631298..74631418 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGGGGACGTCAAGTAAGC Chr13:74631315..74631334 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681031 (Chr13:74631298..74631418 -)
Downstram Exon
ENSMUSE00000570475 (Chr13:74620265..74620391 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGGGGACGTCAAGTAAGC Chr13:74631315..74631334 60.26 55 GCAAATCCCACTCTTCCTCA Chr13:74620312..74620331 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681031 Chr13:74631298..74631418 TGAGGGGACGTCAAGTAAGC Chr13:74631315..74631334 60.26 55
upstream ENSMUSE00000570475 Chr13:74620265..74620391 AGGAAGAGTGGGATTTGCTG Chr13:74620332..74620351 59.28 50

*** Putative Vector Insertion (Chr 13: 74620264 - 74631419) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641164 Chr13:74619987..74620047 No primer for this exon
downstream ENSMUSE00000533419 Chr13:74617502..74618598 AGGGTCTGTTTTGCACTTGG Chr13:74617666..74617685 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACACAACGACTCGGTTTC Chr13:74625421..74625441 59.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACACAACGACTCGGTTTC Chr13:74625421..74625441 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069208