Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35932
Trapped Gene
BC107230 (ENSMUSG00000047257)
Vector Insertion
Chr 9: 110737244 - 110738569
Public Clones IST11040F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000367859 (Chr9:110737092..110737243 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCGCTGGATCCTAATCT Chr9:110737182..110737201 60.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000367859 (Chr9:110737092..110737243 +)
Downstram Exon
ENSMUSE00000405817 (Chr9:110738570..110738596 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCGCTGGATCCTAATCT Chr9:110737182..110737201 60.7 55 CTGGTTCGGTGTAGTTCTCATT Chr9:110738597..110738618 58.25 45.46

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367859 Chr9:110737092..110737243 GAGGCGCTGGATCCTAATCT Chr9:110737182..110737201 60.7 55

*** Putative Vector Insertion (Chr 9: 110737244 - 110738569) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000405817 Chr9:110738570..110738596 CTGGTTCGGTGTAGTTCTCATT Chr9:110738597..110738618 58.25 45.46
downstream ENSMUSE00000370872 Chr9:110740925..110741072 ACCCAGCTTCGATCAATGAG Chr9:110741048..110741067 60.22 50
downstream ENSMUSE00000220143 Chr9:110741526..110741800 GCAATGTCGCTTCTGATGAA Chr9:110741666..110741685 59.96 45
downstream ENSMUSE00000346440 Chr9:110742891..110743054 CCTCCCCATAATTGGTGGTA Chr9:110743046..110743065 59.5 50
downstream ENSMUSE00000384301 Chr9:110743349..110743813 TCTGCCATCGATCTCACAAG Chr9:110743393..110743412 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTCCTTCTCCATTGTCC Chr9:110737255..110737275 59.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTCCTTCTCCATTGTCC Chr9:110737255..110737275 59.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047257