Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35960
Trapped Gene
Trim54 (ENSMUSG00000062077)
Vector Insertion
Chr 5: 31419451 - 31433414
Public Clones CMHD-GT_258H1-3 (cmhd) IST14822C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700030 (Chr5:31419107..31419450 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTCACGGTGGGTTTCAAG Chr5:31419287..31419306 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700030 (Chr5:31419107..31419450 +)
Downstram Exon
ENSMUSE00000271047 (Chr5:31433415..31433587 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTCACGGTGGGTTTCAAG Chr5:31419287..31419306 60.01 50 ACCTCGTGCCTACAAGATGG Chr5:31433503..31433522 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000271057 Chr5:31419085..31419450 ACTTCACGGTGGGTTTCAAG Chr5:31419287..31419306 60.01 50
upstream ENSMUSE00000700030 Chr5:31419107..31419450 ACTTCACGGTGGGTTTCAAG Chr5:31419287..31419306 60.01 50

*** Putative Vector Insertion (Chr 5: 31419451 - 31433414) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271047 Chr5:31433415..31433587 ACCTCGTGCCTACAAGATGG Chr5:31433503..31433522 60.13 55
downstream ENSMUSE00000271038 Chr5:31434361..31434532 TCTGGCGTTTGTAAATGGTG Chr5:31434533..31434552 59.58 45
downstream ENSMUSE00000271026 Chr5:31436423..31436518 ACCTCCTCCATCTGGGTGAT Chr5:31436505..31436524 60.74 55
downstream ENSMUSE00000516747 Chr5:31438416..31438649 GGGTCTCGAACCTCTGGTTT Chr5:31438467..31438486 60.49 55
downstream ENSMUSE00000700032 Chr5:31438416..31438541 GGGTCTCGAACCTCTGGTTT Chr5:31438467..31438486 60.49 55
downstream ENSMUSE00000186410 Chr5:31439126..31439148 No primer for this exon
downstream ENSMUSE00000511323 Chr5:31439261..31439385 GCTCCACGCTCACAGAGAAT Chr5:31439349..31439368 60.56 55
downstream ENSMUSE00000270981 Chr5:31439494..31439586 AGCCATGTCGTCATCCTCTT Chr5:31439531..31439550 59.69 50
downstream ENSMUSE00000700031 Chr5:31439571..31439586 No primer for this exon
downstream ENSMUSE00000475666 Chr5:31439850..31439998 TGGATCAGAGTCGGGTCAGT Chr5:31439884..31439903 60.68 55
downstream ENSMUSE00000700029 Chr5:31439856..31440003 TGGATCAGAGTCGGGTCAGT Chr5:31439884..31439903 60.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGCGATTTCCCAATTTTA Chr5:31428406..31428426 59.9 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGCGATTTCCCAATTTTA Chr5:31428406..31428426 59.9 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062077