Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35963
Trapped Gene
Zfyve19 (ENSMUSG00000068580)
Vector Insertion
Chr 2: 119034920 - 119036217
Public Clones (ggtc) IST14582B11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661811 (Chr2:119034761..119034919 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGAGAACTGCTATGGAGA Chr2:119034853..119034872 60.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661811 (Chr2:119034761..119034919 +)
Downstram Exon
ENSMUSE00000562408 (Chr2:119036218..119036339 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGAGAACTGCTATGGAGA Chr2:119034853..119034872 60.5 55 ACCAGAGCGCTGAAGCTAAG Chr2:119036282..119036301 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661811 Chr2:119034761..119034919 GCCGAGAACTGCTATGGAGA Chr2:119034853..119034872 60.5 55

*** Putative Vector Insertion (Chr 2: 119034920 - 119036217) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562408 Chr2:119036218..119036339 ACCAGAGCGCTGAAGCTAAG Chr2:119036282..119036301 59.92 55
downstream ENSMUSE00000562407 Chr2:119036517..119036567 GGTGACCACTTGGAAGCATT Chr2:119036552..119036571 59.97 50
downstream ENSMUSE00000562406 Chr2:119036917..119037035 GCTTGTTTTCCTGACGAAGC Chr2:119037035..119037054 60 50
downstream ENSMUSE00000562405 Chr2:119037134..119037279 CTAGCCGTGCCTCTATCTCG Chr2:119037175..119037194 60.13 60
downstream ENSMUSE00000562403 Chr2:119037642..119037750 CTGGGTCCTGGTATCTGGTG Chr2:119037674..119037693 60.38 60
downstream ENSMUSE00000562401 Chr2:119040570..119040776 ACAGCCAATCTTTTGGCAAG Chr2:119040753..119040772 60.25 45
downstream ENSMUSE00000562400 Chr2:119041190..119041263 CTGCTGCATGACTCTCTGGA Chr2:119041266..119041285 60.29 55
downstream ENSMUSE00000562399 Chr2:119041945..119042043 TAAAGCCACTTGCCTCATCC Chr2:119041987..119042006 60.21 50
downstream ENSMUSE00000562398 Chr2:119042168..119042277 GCGCAAAGTAGCATCCTCAT Chr2:119042236..119042255 60.38 50
downstream ENSMUSE00000562397 Chr2:119042365..119042785 GCCATGACTCCTCCTCTCAC Chr2:119042651..119042670 59.8 60
downstream ENSMUSE00000685550 Chr2:119042365..119042785 GCCATGACTCCTCCTCTCAC Chr2:119042651..119042670 59.8 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCGAGTGTACTCCCAGAAA Chr2:119034920..119034940 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCGAGTGTACTCCCAGAAA Chr2:119034920..119034940 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068580