Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35965
Trapped Gene
Ccdc68 (ENSMUSG00000038903)
Vector Insertion
Chr 18: 70085275 - 70098495
Public Clones IST10690B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441509 (Chr18:70085213..70085274 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441509 (Chr18:70085213..70085274 +)
Downstram Exon
ENSMUSE00000441500 (Chr18:70098496..70098624 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGAGGGAACTTCTGTGGTCA Chr18:70098546..70098565 59.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441509 Chr18:70085213..70085274 No primer for this exon

*** Putative Vector Insertion (Chr 18: 70085275 - 70098495) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441500 Chr18:70098496..70098624 TGAGGGAACTTCTGTGGTCA Chr18:70098546..70098565 59.23 50
downstream ENSMUSE00000326594 Chr18:70099754..70099840 CATTGCCACAGCCTTCTTTT Chr18:70099820..70099839 60.25 45
downstream ENSMUSE00000326584 Chr18:70103382..70103516 TCCAGGAGCTGCTGATCTTT Chr18:70103485..70103504 60.1 50
downstream ENSMUSE00000326566 Chr18:70106078..70106203 TCGTGCTTTTTCTCCAGGTC Chr18:70106184..70106203 60.38 50
downstream ENSMUSE00000326555 Chr18:70106705..70106833 CCTACGATTTGCCCATGTTT Chr18:70106805..70106824 59.82 45
downstream ENSMUSE00000326539 Chr18:70115636..70115718 AGCGTTGGATTTAAGCTGGA Chr18:70115707..70115726 59.85 45
downstream ENSMUSE00000326520 Chr18:70120055..70120160 GGATGGAAATCTCCGTTTGA Chr18:70120089..70120108 59.87 45
downstream ENSMUSE00000326494 Chr18:70121114..70121197 GGCTTCAAGCACAGTGACCT Chr18:70121197..70121216 60.45 55
downstream ENSMUSE00000326470 Chr18:70126444..70126520 TTGTGGAGACGGCCTTAGAT Chr18:70126522..70126541 59.69 50
downstream ENSMUSE00000441457 Chr18:70128632..70129138 ATCCAGCCAGTTCATTTTCG Chr18:70128703..70128722 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCACAGTATCCCAGCAC Chr18:70091254..70091274 60.69 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCTCCTCTTGCGTGACTG Chr18:70091314..70091334 59.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038903