Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35977
Trapped Gene
A230107C01Rik (ENSMUSG00000049676)
Vector Insertion
Chr 7: 29996465 - 29999003
Public Clones IST12381C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000483681 (Chr7:29998935..29999002 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTTGACCGGTTTTAACCAA Chr7:29998942..29998961 59.7 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000483681 (Chr7:29998935..29999002 -)
Downstram Exon
ENSMUSE00000492894 (Chr7:29996466..29996514 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTTGACCGGTTTTAACCAA Chr7:29998942..29998961 59.7 45 ACTCTTCGCCAAGTCCCTCT Chr7:29996446..29996465 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000483681 Chr7:29998935..29999002 GGTTGACCGGTTTTAACCAA Chr7:29998942..29998961 59.7 45
upstream ENSMUSE00000492894 Chr7:29996466..29996514 AGAGGGACTTGGCGAAGAGT Chr7:29996468..29996487 60.39 55

*** Putative Vector Insertion (Chr 7: 29996465 - 29999003) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000510861 Chr7:29995766..29995944 ACTAGCCGCAGTACCCAGAA Chr7:29995826..29995845 59.9 55
downstream ENSMUSE00000474856 Chr7:29995661..29995933 ACTAGCCGCAGTACCCAGAA Chr7:29995826..29995845 59.9 55
downstream ENSMUSE00000676041 Chr7:29995661..29995774 GATGCAAGCCTACCTTCTCG Chr7:29995731..29995750 59.98 55
downstream ENSMUSE00000463117 Chr7:29995499..29995552 CCGGACAGGAAAAGTTGATT Chr7:29995482..29995501 59.03 45
downstream ENSMUSE00000676040 Chr7:29995499..29995552 CCGGACAGGAAAAGTTGATT Chr7:29995482..29995501 59.03 45
downstream ENSMUSE00000635851 Chr7:29991824..29991968 CCATCTCCCAACGGTAGAAA Chr7:29991847..29991866 59.93 50
downstream ENSMUSE00000635849 Chr7:29991573..29991699 TGAAGGGCCCTATACCATTG Chr7:29991564..29991583 59.78 50
downstream ENSMUSE00000635848 Chr7:29991348..29991420 TGGCGAATAAGGATTTACCAC Chr7:29991337..29991357 58.96 42.86
downstream ENSMUSE00000635847 Chr7:29989786..29989941 CCACAGGGGTCTTGATTTTG Chr7:29989866..29989885 60.35 50
downstream ENSMUSE00000247726 Chr7:29987283..29987454 TTTTGTCAAAGAGCGTGCTG Chr7:29987273..29987292 60.17 45
downstream ENSMUSE00000247718 Chr7:29985136..29985273 AATACACCGGGCACAGTCTC Chr7:29985195..29985214 60 55
downstream ENSMUSE00000635846 Chr7:29983368..29983427 CATCTGGCACCATCTCGAAG Chr7:29983373..29983392 61.77 55
downstream ENSMUSE00000247712 Chr7:29983132..29983239 CAGTCGATGCTGCAGTTTTT Chr7:29983196..29983215 59.08 45
downstream ENSMUSE00000398471 Chr7:29982233..29982283 No primer for this exon
downstream ENSMUSE00000365577 Chr7:29981994..29982123 GATGAAGTTGCCCCAGATGT Chr7:29981980..29981999 59.93 50
downstream ENSMUSE00000419965 Chr7:29981769..29983427 AAAGGCCTACCACCCTCCTA Chr7:29983289..29983308 59.96 55
downstream ENSMUSE00000516446 Chr7:29980847..29980958 GAAGTCCGCCAGAAAAATGA Chr7:29980900..29980919 60.19 45
downstream ENSMUSE00000635839 Chr7:29980233..29980342 TTGGGCAGGTTGTACTCCAT Chr7:29980235..29980254 60.38 50
downstream ENSMUSE00000454812 Chr7:29976554..29976767 TAGCTCTCTGTGCGTGATGC Chr7:29976647..29976666 60.32 55
downstream ENSMUSE00000635838 Chr7:29976554..29976767 TAGCTCTCTGTGCGTGATGC Chr7:29976647..29976666 60.32 55
downstream ENSMUSE00000635836 Chr7:29975746..29975808 TTGTTTTGTGTTGCCACCAG Chr7:29975732..29975751 60.59 45
downstream ENSMUSE00000676036 Chr7:29975746..29975808 TTGTTTTGTGTTGCCACCAG Chr7:29975732..29975751 60.59 45
downstream ENSMUSE00000519528 Chr7:29975456..29975654 TTGGTAGGCGTTCATGTTGA Chr7:29975561..29975580 60.11 45
downstream ENSMUSE00000635835 Chr7:29975456..29975654 TTGGTAGGCGTTCATGTTGA Chr7:29975561..29975580 60.11 45
downstream ENSMUSE00000635834 Chr7:29975232..29975350 GATCCGCCAGTACCAGAGAC Chr7:29975275..29975294 59.69 60
downstream ENSMUSE00000676035 Chr7:29975232..29975350 GATCCGCCAGTACCAGAGAC Chr7:29975275..29975294 59.69 60
downstream ENSMUSE00000519477 Chr7:29974966..29975046 CCTGTTCGGAGCATCTCTTT Chr7:29974988..29975007 59.43 50
downstream ENSMUSE00000635833 Chr7:29974966..29975046 CCTGTTCGGAGCATCTCTTT Chr7:29974988..29975007 59.43 50
downstream ENSMUSE00000520384 Chr7:29974829..29974885 AATGTGGTCCCCAAGGTACG Chr7:29974810..29974829 61.94 55
downstream ENSMUSE00000635832 Chr7:29974829..29974885 AATGTGGTCCCCAAGGTACG Chr7:29974810..29974829 61.94 55
downstream ENSMUSE00000502722 Chr7:29970456..29970612 GCATCTCGGCGTCTTTAATC Chr7:29970455..29970474 59.81 50
downstream ENSMUSE00000635831 Chr7:29970456..29970612 GCATCTCGGCGTCTTTAATC Chr7:29970455..29970474 59.81 50
downstream ENSMUSE00000635781 Chr7:29970207..29970270 AGAGTCGCCAGTCACCAAGT Chr7:29970202..29970221 59.91 55
downstream ENSMUSE00000635830 Chr7:29970207..29970270 AGAGTCGCCAGTCACCAAGT Chr7:29970202..29970221 59.91 55
downstream ENSMUSE00000635829 Chr7:29969698..29970109 GAGTCCCCTGCATAACTGGA Chr7:29969908..29969927 60.07 55
downstream ENSMUSE00000676034 Chr7:29969698..29970109 GAGTCCCCTGCATAACTGGA Chr7:29969908..29969927 60.07 55
downstream ENSMUSE00000676039 Chr7:29967256..29967348 TAGCAAGGGGAGTTCTCCAA Chr7:29967297..29967316 59.81 50
downstream ENSMUSE00000676038 Chr7:29967052..29967151 No primer for this exon
downstream ENSMUSE00000676037 Chr7:29966553..29966945 AGGAGAGGCCTAAGGGTTCA Chr7:29966625..29966644 60.2 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATTTTAGGAGCTGGAAA Chr7:29998989..29999009 59.3 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCATTTTAGGAGCTGGAAA Chr7:29998989..29999009 59.3 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049676