Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36015
Trapped Gene
A430107P09Rik (ENSMUSG00000076928)
Vector Insertion
Chr 14: 54841826 - 54842665
Public Clones IST12881B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000663888 (Chr14:54841781..54841825 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCACGTTGACTGAGAAAA Chr14:54841794..54841813 60.43 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000663888 (Chr14:54841781..54841825 +)
Downstram Exon
ENSMUSE00000663889 (Chr14:54842666..54842772 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCACGTTGACTGAGAAAA Chr14:54841794..54841813 60.43 45 AAATCCGGCTACTTTCAGCA Chr14:54842739..54842758 59.85 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000663890 Chr14:54840196..54840456 AAATCAATGTGCCGAAAACC Chr14:54840286..54840305 59.81 40
upstream ENSMUSE00000663888 Chr14:54841781..54841825 TGCCACGTTGACTGAGAAAA Chr14:54841794..54841813 60.43 45

*** Putative Vector Insertion (Chr 14: 54841826 - 54842665) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000663889 Chr14:54842666..54842772 AAATCCGGCTACTTTCAGCA Chr14:54842739..54842758 59.85 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCCACGTTGACTGAGAAA Chr14:54841794..54841814 59.29 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGCCACGTTGACTGAGAAA Chr14:54841794..54841814 59.29 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000076928