Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36020
Trapped Gene
D14Ertd436e (ENSMUSG00000037526)
Vector Insertion
Chr 14: 48180295 - 48188090
Public Clones IST14502B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000373419 (Chr14:48187861..48188089 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTTACGTGGCTGTTGAGC Chr14:48187958..48187977 60.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000373419 (Chr14:48187861..48188089 -)
Downstram Exon
ENSMUSE00000382522 (Chr14:48180296..48180358 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTTACGTGGCTGTTGAGC Chr14:48187958..48187977 60.83 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000373419 Chr14:48187861..48188089 CCTTTACGTGGCTGTTGAGC Chr14:48187958..48187977 60.83 55
upstream ENSMUSE00000382522 Chr14:48180296..48180358 No primer for this exon

*** Putative Vector Insertion (Chr 14: 48180295 - 48188090) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000342057 Chr14:48178849..48178891 TAAGCCGCTTTCCTTCCATA Chr14:48178838..48178857 59.81 45
downstream ENSMUSE00000374912 Chr14:48174235..48174316 TTGCTTCAGCTGTTCAATCC Chr14:48174247..48174266 59 45
downstream ENSMUSE00000312318 Chr14:48170923..48171160 GTTGTGCCGCTGAATCTTCT Chr14:48171041..48171060 60.41 50
downstream ENSMUSE00000312312 Chr14:48168594..48168823 CCCGTTGTTTGGTAGGCTAA Chr14:48168627..48168646 59.99 50
downstream ENSMUSE00000312305 Chr14:48166916..48167033 GTGTAGGCGGGGTTGTTATG Chr14:48166984..48167003 60.25 55
downstream ENSMUSE00000312298 Chr14:48165466..48165556 GAGGTTTTCGCCACAGAACT Chr14:48165513..48165532 59.33 50
downstream ENSMUSE00000312288 Chr14:48165303..48165388 TGACCAAGTGCATCAGGTTC Chr14:48165306..48165325 59.68 50
downstream ENSMUSE00000370303 Chr14:48160569..48162818 TCATCGCTTACACGCTCATC Chr14:48162689..48162708 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr14:48185019..48185039 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGATGCACCTGGATAAAAA Chr14:48185117..48185138 59.95 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037526