Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36029
Trapped Gene
Myst3 (ENSMUSG00000031540)
Vector Insertion
Chr 8: 23972075 - 23972359
Public Clones IST10070G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000418951 (Chr8:23971989..23972074 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTGGAGGACGAGTTGACC Chr8:23972045..23972064 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000418951 (Chr8:23971989..23972074 +)
Downstram Exon
ENSMUSE00000258112 (Chr8:23972360..23973273 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTGGAGGACGAGTTGACC Chr8:23972045..23972064 59.97 55 TTTCCTCTGAAGGTCGCTGT Chr8:23972767..23972786 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684999 Chr8:23970007..23970104 GTGTCAGTTTGGGGCATCTC Chr8:23970039..23970058 60.52 55
upstream ENSMUSE00000418956 Chr8:23970011..23970104 GTGTCAGTTTGGGGCATCTC Chr8:23970039..23970058 60.52 55
upstream ENSMUSE00000418951 Chr8:23971989..23972074 ATGTGGAGGACGAGTTGACC Chr8:23972045..23972064 59.97 55

*** Putative Vector Insertion (Chr 8: 23972075 - 23972359) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000258112 Chr8:23972360..23973273 TTTCCTCTGAAGGTCGCTGT Chr8:23972767..23972786 59.99 50
downstream ENSMUSE00000714923 Chr8:23972360..23973273 TTTCCTCTGAAGGTCGCTGT Chr8:23972767..23972786 59.99 50
downstream ENSMUSE00000258096 Chr8:24013580..24013688 ACAGATGGGGATTGGTTCAG Chr8:24013609..24013628 59.78 50
downstream ENSMUSE00000258091 Chr8:24018118..24018233 CCGTAAGGCCTTCACTCTCA Chr8:24018179..24018198 60.39 55
downstream ENSMUSE00000258084 Chr8:24018715..24018796 CGTGTAAGTGGTGGGTCACA Chr8:24018788..24018807 60.48 55
downstream ENSMUSE00000258078 Chr8:24020604..24020739 GTTTTATCTGTGCCGCCTTC Chr8:24020684..24020703 59.71 50
downstream ENSMUSE00000257472 Chr8:24022132..24022448 AAGGGGGCATTGCTATCTCT Chr8:24022287..24022306 60.06 50
downstream ENSMUSE00000418924 Chr8:24024741..24024859 AGCCGTTCCTCATTTTCTTG Chr8:24024789..24024808 59.31 45
downstream ENSMUSE00000418919 Chr8:24029797..24029912 No primer for this exon
downstream ENSMUSE00000210583 Chr8:24033987..24034128 ATCTCATTGGCAGGAGGATG Chr8:24034100..24034119 60.03 50
downstream ENSMUSE00000210585 Chr8:24035753..24035914 TGGTACTCACGTTCCCATCA Chr8:24035777..24035796 59.96 50
downstream ENSMUSE00000418903 Chr8:24036849..24036942 CCGTAGCCCTTACGTTGGTA Chr8:24036925..24036944 60.01 55
downstream ENSMUSE00000418898 Chr8:24039688..24039919 CATTCGTAGGTGGTGCAGTG Chr8:24039902..24039921 60.17 55
downstream ENSMUSE00000258041 Chr8:24040637..24040850 ATCTACAGGCCGAAGGTTCA Chr8:24040715..24040734 59.69 50
downstream ENSMUSE00000257450 Chr8:24042587..24043186 ACTTTTCCTCGCAGTCTCCA Chr8:24042872..24042891 59.99 50
downstream ENSMUSE00000391644 Chr8:24045952..24046270 TCTTTAGACGGCCTCTTGGA Chr8:24046235..24046254 59.95 50
downstream ENSMUSE00000351861 Chr8:24048461..24053734 GGTTTGTACATGCGGCTTTT Chr8:24053482..24053501 60 45
downstream ENSMUSE00000684998 Chr8:24048461..24053731 GGTTTGTACATGCGGCTTTT Chr8:24053482..24053501 60 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACAATGTGGAGGACGAGT Chr8:23972041..23972061 59.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACAATGTGGAGGACGAGT Chr8:23972041..23972061 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031540