Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36038
Trapped Gene
Jmjd2c (ENSMUSG00000028397)
Vector Insertion
Chr 4: 73888545 - 73897782
Public Clones IST14277F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000486245 (Chr4:73888401..73888544 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000486245 (Chr4:73888401..73888544 +)
Downstram Exon
ENSMUSE00000399503 (Chr4:73897783..73897990 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGAAGACTTGTTCCGCACT Chr4:73897911..73897930 60.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486245 Chr4:73888401..73888544 No primer for this exon

*** Putative Vector Insertion (Chr 4: 73888545 - 73897782) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399503 Chr4:73897783..73897990 TGGAAGACTTGTTCCGCACT Chr4:73897911..73897930 60.83 50
downstream ENSMUSE00000632197 Chr4:73908713..73908873 GGATTCCATGTATGCGAGGT Chr4:73908846..73908865 59.78 50
downstream ENSMUSE00000710008 Chr4:73908713..73908873 GGATTCCATGTATGCGAGGT Chr4:73908846..73908865 59.78 50
downstream ENSMUSE00000330084 Chr4:73917098..73917273 CATCTGCTGAATTGGTGCTG Chr4:73917184..73917203 60.41 50
downstream ENSMUSE00000330076 Chr4:73926801..73926915 TTTCCAGTATTTGCGTTCCA Chr4:73926858..73926877 59.16 40
downstream ENSMUSE00000662754 Chr4:73944345..73944538 GAGATCCATGTCCTCCGTGT Chr4:73944500..73944519 59.93 55
downstream ENSMUSE00000178776 Chr4:73952869..73952918 TTTCAAGTCGCTTTCCATGC Chr4:73952909..73952928 61.28 45
downstream ENSMUSE00000330062 Chr4:73957551..73957654 GGGAGCTACTGGGGAAGAAG Chr4:73957574..73957593 60.2 60
downstream ENSMUSE00000178777 Chr4:73961416..73961553 GCAACCTTGCCGTAGTCAAT Chr4:73961549..73961568 60.14 50
downstream ENSMUSE00000178785 Chr4:73976559..73976752 CATGTCATTCCGACAAGTGC Chr4:73976582..73976601 60.12 50
downstream ENSMUSE00000716477 Chr4:73979537..73979772 CCCCAGCTTTAATGCTTTTTC Chr4:73979689..73979709 60.08 42.86
downstream ENSMUSE00000716571 Chr4:73979537..73979772 CCCCAGCTTTAATGCTTTTTC Chr4:73979689..73979709 60.08 42.86
downstream ENSMUSE00000330040 Chr4:73980453..73980772 GATGGCCATGAGAAAGTGGT Chr4:73980581..73980600 59.93 50
downstream ENSMUSE00000672664 Chr4:73980453..73980772 GATGGCCATGAGAAAGTGGT Chr4:73980581..73980600 59.93 50
downstream ENSMUSE00000330032 Chr4:73982786..73982894 ATCACTCGCTACCTGCTGCT Chr4:73982893..73982912 60.19 55
downstream ENSMUSE00000672661 Chr4:73982786..73982894 ATCACTCGCTACCTGCTGCT Chr4:73982893..73982912 60.19 55
downstream ENSMUSE00000178774 Chr4:73989274..73989455 CAGAGTGCAGATGGCACAGT Chr4:73989440..73989459 60.06 55
downstream ENSMUSE00000672658 Chr4:73989274..73989455 CAGAGTGCAGATGGCACAGT Chr4:73989440..73989459 60.06 55
downstream ENSMUSE00000178775 Chr4:73991347..73991560 TCTTCAAGGAAGGCATTTGG Chr4:73991507..73991526 60.18 45
downstream ENSMUSE00000672656 Chr4:73991347..73991560 TCTTCAAGGAAGGCATTTGG Chr4:73991507..73991526 60.18 45
downstream ENSMUSE00000178784 Chr4:73994304..73994380 CACAGCCATCCATCACAGAC Chr4:73994352..73994371 60.12 55
downstream ENSMUSE00000672654 Chr4:73994304..73994380 CACAGCCATCCATCACAGAC Chr4:73994352..73994371 60.12 55
downstream ENSMUSE00000178788 Chr4:74003246..74003301 TCCCCTCAAATTGCAGAGAC Chr4:74003275..74003294 60.19 50
downstream ENSMUSE00000672652 Chr4:74003246..74003301 TCCCCTCAAATTGCAGAGAC Chr4:74003275..74003294 60.19 50
downstream ENSMUSE00000178782 Chr4:74005324..74005432 CTGGAACTGCAACAGCACAT Chr4:74005361..74005380 59.9 50
downstream ENSMUSE00000672651 Chr4:74005324..74005432 CTGGAACTGCAACAGCACAT Chr4:74005361..74005380 59.9 50
downstream ENSMUSE00000178783 Chr4:74019470..74019655 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55
downstream ENSMUSE00000672650 Chr4:74019470..74019655 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55
downstream ENSMUSE00000178787 Chr4:74023534..74023704 CCGAGTGTTTCGATGTTTTG Chr4:74023605..74023624 59.17 45
downstream ENSMUSE00000672649 Chr4:74023534..74023704 CCGAGTGTTTCGATGTTTTG Chr4:74023605..74023624 59.17 45
downstream ENSMUSE00000178779 Chr4:74037281..74037400 GGCCATTTGACTTGGATGAC Chr4:74037345..74037364 60.33 50
downstream ENSMUSE00000672648 Chr4:74037281..74037400 GGCCATTTGACTTGGATGAC Chr4:74037345..74037364 60.33 50
downstream ENSMUSE00000329972 Chr4:74045251..74045343 CAATCTGCGATCCATCTTCA Chr4:74045281..74045300 59.76 45
downstream ENSMUSE00000672646 Chr4:74045251..74045343 CAATCTGCGATCCATCTTCA Chr4:74045281..74045300 59.76 45
downstream ENSMUSE00000445447 Chr4:74050725..74051765 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55
downstream ENSMUSE00000662753 Chr4:74050725..74051764 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55
downstream ENSMUSE00000672645 Chr4:74050725..74051765 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGCATCATCAATCCGTAA Chr4:73894530..73894550 58.49 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGACAGCTTCTTTATTCC Chr4:73891535..73891555 58.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028397