Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36058
Trapped Gene
Slc29a2 (ENSMUSG00000024891)
Vector Insertion
Chr 19: 5024278 - 5024510
Public Clones IST13077C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145893 (Chr19:5024071..5024277 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACGTGGTCCGCAGTGTAAC Chr19:5024086..5024105 61.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145893 (Chr19:5024071..5024277 +)
Downstram Exon
ENSMUSE00000253630 (Chr19:5024511..5024592 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACGTGGTCCGCAGTGTAAC Chr19:5024086..5024105 61.02 55 TGAAGAAGCTGATCCCAACC Chr19:5024542..5024561 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000145893 Chr19:5024071..5024277 AACGTGGTCCGCAGTGTAAC Chr19:5024086..5024105 61.02 55

*** Putative Vector Insertion (Chr 19: 5024278 - 5024510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253630 Chr19:5024511..5024592 TGAAGAAGCTGATCCCAACC Chr19:5024542..5024561 60.19 50
downstream ENSMUSE00000253612 Chr19:5026028..5026188 AAGGAGTTGAGGAGCGTGAA Chr19:5026179..5026198 59.99 50
downstream ENSMUSE00000145878 Chr19:5026358..5026497 GAGCAGTAGTATGGCCAGCA Chr19:5026412..5026431 59.05 55
downstream ENSMUSE00000145904 Chr19:5027025..5027159 GGCCAAGGACATGAGCATAG Chr19:5027161..5027180 60.62 55
downstream ENSMUSE00000145875 Chr19:5027343..5027440 TACGATGGAGAGGAGGATGC Chr19:5027419..5027438 60.18 55
downstream ENSMUSE00000253525 Chr19:5027680..5027764 GAGACAGCTTCTCGGTCAGG Chr19:5027719..5027738 60.13 60
downstream ENSMUSE00000145876 Chr19:5028841..5028971 ATGGGAACCCCATTCTTCTC Chr19:5028865..5028884 60.13 50
downstream ENSMUSE00000145896 Chr19:5029212..5029320 AAAGACCGACAGGGTGACTG Chr19:5029271..5029290 60.15 55
downstream ENSMUSE00000145901 Chr19:5029409..5029494 TCCATGACGTTGAAGAGCAG Chr19:5029460..5029479 59.98 50
downstream ENSMUSE00000145898 Chr19:5030288..5030490 GAGCAGCATGAAGGTGATGA Chr19:5030440..5030459 59.95 50
downstream ENSMUSE00000344437 Chr19:5031002..5031963 CTTCCCCTCAGTTTCCATGA Chr19:5031583..5031602 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr19:5024329..5024349 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000024891