Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36068
Trapped Gene
Dok5 (ENSMUSG00000027560)
Vector Insertion
Chr 2: 170557689 - 170626349
Public Clones (sanger) IST12233A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503662 (Chr2:170557440..170557688 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACCGCATCACCTTGTTA Chr2:170557494..170557513 60.11 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503662 (Chr2:170557440..170557688 +)
Downstram Exon
ENSMUSE00000502770 (Chr2:170626350..170626457 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACCGCATCACCTTGTTA Chr2:170557494..170557513 60.11 45 ACCCTTGCTCGAAGCTTTCT Chr2:170626400..170626419 60.52 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503662 Chr2:170557440..170557688 TTCACCGCATCACCTTGTTA Chr2:170557494..170557513 60.11 45

*** Putative Vector Insertion (Chr 2: 170557689 - 170626349) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000502770 Chr2:170626350..170626457 ACCCTTGCTCGAAGCTTTCT Chr2:170626400..170626419 60.52 50
downstream ENSMUSE00000266197 Chr2:170655340..170655454 GCAAAGGTCTTCGAGGTGTC Chr2:170655446..170655465 59.85 55
downstream ENSMUSE00000170524 Chr2:170655569..170655688 ACCCCGGTAGCCAATAAATC Chr2:170655674..170655693 60.04 50
downstream ENSMUSE00000170522 Chr2:170658382..170658571 ACTTAGCGGCCAAGAGATGA Chr2:170658521..170658540 59.98 50
downstream ENSMUSE00000266175 Chr2:170666920..170667055 TAACCCTTCGCCAGTCTCAC Chr2:170666947..170666966 60.26 55
downstream ENSMUSE00000497478 Chr2:170696311..170696431 CTGTGCTGCCTCGTGATATG Chr2:170696408..170696427 60.44 55
downstream ENSMUSE00000496597 Chr2:170704674..170705268 TATCCAGTGCGTTTCCATGA Chr2:170705084..170705103 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGATCTCTTGGTGACTGAAA Chr2:170557680..170557701 60.24 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAAAGCCGTGACTGGGAAA Chr2:170557733..170557753 60.61 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027560