Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3607
Trapped Gene
Actr8 (ENSMUSG00000015971)
Vector Insertion
Chr 14: 30795956 - 30797215
Public Clones BA0561 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000122742 (Chr14:30795785..30795955 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000122742 (Chr14:30795785..30795955 +)
Downstram Exon
ENSMUSE00000122738 (Chr14:30797216..30797326 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414509 Chr14:30791572..30791774 No primer for this exon
upstream ENSMUSE00000122742 Chr14:30795785..30795955 No primer for this exon

*** Putative Vector Insertion (Chr 14: 30795956 - 30797215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122738 Chr14:30797216..30797326 No primer for this exon
downstream ENSMUSE00000122722 Chr14:30799112..30799216 No primer for this exon
downstream ENSMUSE00000122741 Chr14:30799463..30799636 No primer for this exon
downstream ENSMUSE00000122740 Chr14:30800108..30800201 No primer for this exon
downstream ENSMUSE00000122739 Chr14:30800405..30800537 No primer for this exon
downstream ENSMUSE00000122720 Chr14:30801375..30801528 No primer for this exon
downstream ENSMUSE00000122744 Chr14:30802139..30802234 No primer for this exon
downstream ENSMUSE00000122733 Chr14:30802846..30802986 No primer for this exon
downstream ENSMUSE00000244131 Chr14:30803890..30804154 No primer for this exon
downstream ENSMUSE00000122735 Chr14:30804778..30804941 No primer for this exon
downstream ENSMUSE00000122731 Chr14:30806147..30806399 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCTCCTAAGGGAAGGACT Chr14:30795933..30795953 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCTCCTAAGGGAAGGACT Chr14:30795933..30795953 60.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015971