Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36085
Trapped Gene
2610203C20Rik (ENSMUSG00000074415)
Vector Insertion
Chr 9: 41389486 - 41398302
Public Clones IST15106H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637708 (Chr9:41389257..41389485 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637708 (Chr9:41389257..41389485 +)
Downstram Exon
ENSMUSE00000637707 (Chr9:41398303..41398397 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637710 Chr9:41389111..41389254 No primer for this exon
upstream ENSMUSE00000637708 Chr9:41389257..41389485 No primer for this exon

*** Putative Vector Insertion (Chr 9: 41389486 - 41398302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637707 Chr9:41398303..41398397 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCATGCTTGGAATTGCTTG Chr9:41389456..41389476 59.42 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTTACGTGACTGGGAAA Chr9:41389530..41389550 58.92 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074415