Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36088
Trapped Gene
Dnajc17 (ENSMUSG00000034278)
Vector Insertion
Chr 2: 119009334 - 119009739
Public Clones IST13100G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307729 (Chr2:119009653..119009738 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGGAGTGAGGAAGAGGA Chr2:119009687..119009706 60.19 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307729 (Chr2:119009653..119009738 -)
Downstram Exon
ENSMUSE00000307719 (Chr2:119009335..119009431 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGGAGTGAGGAAGAGGA Chr2:119009687..119009706 60.19 55 ACTGACGGGAACCCTCTTCT Chr2:119009376..119009395 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000307758 Chr2:119034424..119034510 ACTAGAACCATGGCGGTGAC Chr2:119034491..119034510 60 55
upstream ENSMUSE00000307752 Chr2:119012082..119012151 AAGAAGGCGTACAGGCAAAA Chr2:119012129..119012148 59.88 45
upstream ENSMUSE00000307747 Chr2:119011765..119011823 AACTCTTCCACCAGCTGTCC Chr2:119011801..119011820 59.31 55
upstream ENSMUSE00000307739 Chr2:119011432..119011519 GGACCCAGAGACTTGACGAG Chr2:119011454..119011473 59.83 60
upstream ENSMUSE00000307729 Chr2:119009653..119009738 CATGGGAGTGAGGAAGAGGA Chr2:119009687..119009706 60.19 55
upstream ENSMUSE00000307719 Chr2:119009335..119009431 AGAAGAGGGTTCCCGTCAGT Chr2:119009398..119009417 60.11 55

*** Putative Vector Insertion (Chr 2: 119009334 - 119009739) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307708 Chr2:119006662..119006705 GGGTTCCTTTGCCTTCAGTA Chr2:119006651..119006670 59.17 50
downstream ENSMUSE00000307697 Chr2:119006223..119006300 CTCTGGAGTAGCCACCTTGG Chr2:119006227..119006246 59.86 60
downstream ENSMUSE00000307689 Chr2:119005621..119005701 CATTGCCTGCCTTCTTTCTG Chr2:119005631..119005650 60.9 50
downstream ENSMUSE00000307679 Chr2:119005088..119005198 CTCCAACCAGGAAACCTTCA Chr2:119005114..119005133 60.08 50
downstream ENSMUSE00000384836 Chr2:118998243..118998421 TCCCTTTCTGACAGCACTGA Chr2:118998377..118998396 59.54 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000034278