Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36096
Trapped Gene
Myo5a (ENSMUSG00000034593)
Vector Insertion
Chr 9: 74919467 - 74963782
Public Clones IST11836G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695848 (Chr9:74918995..74919466 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGTCCGAGCTCTACACCAAG Chr9:74919447..74919466 60.98 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695848 (Chr9:74918995..74919466 +)
Downstram Exon
ENSMUSE00000695814 (Chr9:74963783..74963809 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGTCCGAGCTCTACACCAAG Chr9:74919447..74919466 60.98 60 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695848 Chr9:74918995..74919466 CGTCCGAGCTCTACACCAAG Chr9:74919447..74919466 60.98 60

*** Putative Vector Insertion (Chr 9: 74919467 - 74963782) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695814 Chr9:74963783..74963809 No primer for this exon
downstream ENSMUSE00000447610 Chr9:74963993..74964103 AACTCTGCCGATTTCCACAC Chr9:74964048..74964067 60.12 50
downstream ENSMUSE00000278457 Chr9:74968480..74968651 TCAGGGTTCCGTAAGTGAGG Chr9:74968541..74968560 60.1 55
downstream ENSMUSE00000531833 Chr9:74970718..74970862 ATAGGCAGCTGCTCATAGGG Chr9:74970763..74970782 59.46 55
downstream ENSMUSE00000278946 Chr9:74977779..74977935 CGCATGGCATACTTAGCAGA Chr9:74977859..74977878 60 50
downstream ENSMUSE00000279095 Chr9:74984150..74984293 TCTCATATTGGCACCGATGA Chr9:74984260..74984279 60.03 45
downstream ENSMUSE00000279071 Chr9:74988455..74988536 TAACTTTGCCGAAGCACAGA Chr9:74988514..74988533 59.61 45
downstream ENSMUSE00000278923 Chr9:74989242..74989349 CCATCTCCTTCGCATCATCT Chr9:74989322..74989341 60.18 50
downstream ENSMUSE00000278902 Chr9:74991880..74991986 CTGAATCCCGAGATGCAAAT Chr9:74991972..74991991 60.04 45
downstream ENSMUSE00000279028 Chr9:74994672..74994937 TCCACACCCATAAGGTCACA Chr9:74994721..74994740 59.81 50
downstream ENSMUSE00000278872 Chr9:74995663..74995744 No primer for this exon
downstream ENSMUSE00000531830 Chr9:74999700..74999840 CTCATCCAGCAAATCGAGAA Chr9:74999834..74999853 58.95 45
downstream ENSMUSE00000278828 Chr9:75001563..75001688 TACAGTTTTTGGGCCCATGT Chr9:75001606..75001625 60.23 45
downstream ENSMUSE00000278634 Chr9:75003989..75004072 No primer for this exon
downstream ENSMUSE00000278417 Chr9:75008225..75008386 GTGGGCTTTACAGGAACTCG Chr9:75008334..75008353 59.73 55
downstream ENSMUSE00000278759 Chr9:75009239..75009336 AGTGGCATTAAGGGTTTCCA Chr9:75009286..75009305 59.43 45
downstream ENSMUSE00000278743 Chr9:75011937..75012023 CTGCACTGCCCTCTTCTCAT Chr9:75011964..75011983 60.56 55
downstream ENSMUSE00000278724 Chr9:75012103..75012211 TGCTTCATTAGGACCCGGTA Chr9:75012153..75012172 60.46 50
downstream ENSMUSE00000278378 Chr9:75014826..75015037 ATAGGCCACTTGACCAGCAC Chr9:75014891..75014910 60.14 55
downstream ENSMUSE00000278528 Chr9:75016732..75016888 CATGCGCCAGTACTTTTGAA Chr9:75016795..75016814 59.87 45
downstream ENSMUSE00000278320 Chr9:75019346..75019585 CACAGAGCGAGCCTCAATTT Chr9:75019516..75019535 60.54 50
downstream ENSMUSE00000278296 Chr9:75021759..75022007 CCAGTGGCAACCTTAGCTTC Chr9:75021892..75021911 59.88 55
downstream ENSMUSE00000278273 Chr9:75024325..75024418 GGTGGTTGAGGGTCTCCTTT Chr9:75024391..75024410 60.35 55
downstream ENSMUSE00000278258 Chr9:75027831..75027979 GAGGTCATCATAGCGCTCCT Chr9:75027958..75027977 59.42 55
downstream ENSMUSE00000278244 Chr9:75029706..75029819 GTGTCCTGGCTTAGGCACAT Chr9:75029729..75029748 60.14 55
downstream ENSMUSE00000278227 Chr9:75032085..75032228 CTCTGTGACACGCTTCTGGA Chr9:75032156..75032175 60.18 55
downstream ENSMUSE00000278207 Chr9:75032445..75032498 No primer for this exon
downstream ENSMUSE00000278166 Chr9:75033702..75033929 TCTGGGGCACTTTTCTCACT Chr9:75033790..75033809 59.84 50
downstream ENSMUSE00000695813 Chr9:75035329..75035337 No primer for this exon
downstream ENSMUSE00000278136 Chr9:75037707..75037807 TGCTTGTGCTATTTCACCTTTG Chr9:75037782..75037803 60.3 40.91
downstream ENSMUSE00000695826 Chr9:75040191..75040271 TCCATCCTCATTCAACTCCTG Chr9:75040232..75040252 60.06 47.62
downstream ENSMUSE00000278109 Chr9:75041746..75041944 CTGTTGCCGGTTGTTTTCTT Chr9:75041854..75041873 60.15 45
downstream ENSMUSE00000278080 Chr9:75043933..75044007 No primer for this exon
downstream ENSMUSE00000278065 Chr9:75045450..75045543 CCGGACAGTTTTATCCTGCT Chr9:75045494..75045513 59.19 50
downstream ENSMUSE00000278041 Chr9:75049079..75049225 TTTTCTTTCCGGGGAATGTT Chr9:75049160..75049179 60.64 40
downstream ENSMUSE00000278011 Chr9:75051515..75051669 CAGATTGACAGCCACACCAC Chr9:75051549..75051568 60.16 55
downstream ENSMUSE00000277985 Chr9:75057021..75057110 TTGCTTCAAACAGTGCAAAA Chr9:75057098..75057117 58.1 35
downstream ENSMUSE00000531822 Chr9:75058825..75058975 CGAGACGTGTTGTGCTTCAT Chr9:75058853..75058872 59.9 50
downstream ENSMUSE00000277942 Chr9:75060599..75060881 CCAGATACGCCCTGAATTGT Chr9:75060644..75060663 59.96 50
downstream ENSMUSE00000277922 Chr9:75062892..75063066 TTCTGCGTCATCGTCAGTTT Chr9:75063030..75063049 59.44 45
downstream ENSMUSE00000277902 Chr9:75065306..75065386 CCGGTGTGTACAGATTCAACA Chr9:75065338..75065358 59.47 47.62
downstream ENSMUSE00000635517 Chr9:75065648..75071495 CACGGGGCTGTATTCACTTT Chr9:75070768..75070787 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTTTAATCGCCTTGCAG Chr9:74940512..74940532 58.53 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAGCTCTACACCAAGGTAAC Chr9:74931451..74931473 60.19 54.54 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034593