Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36097
Trapped Gene
Tssc4 (ENSMUSG00000045752)
Vector Insertion
Chr 7: 150255756 - 150255840
Public Clones IST13599D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411975 (Chr7:150255660..150255755 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTGTGCGCGCTAGGATAC Chr7:150255667..150255686 60.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411975 (Chr7:150255660..150255755 +)
Downstram Exon
ENSMUSE00000667983 (Chr7:150255841..150256197 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTGTGCGCGCTAGGATAC Chr7:150255667..150255686 60.4 55 GAGGGAGACGGTGTCAGAAG Chr7:150255942..150255961 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371531 Chr7:150255273..150255418 AAGCCACGAAAATCTGATCG Chr7:150255281..150255300 60.21 45
upstream ENSMUSE00000705417 Chr7:150255338..150255418 GCAGGGTATTGAGGCGTGTA Chr7:150255385..150255404 61.05 55
upstream ENSMUSE00000411975 Chr7:150255660..150255755 ATCTGTGCGCGCTAGGATAC Chr7:150255667..150255686 60.4 55

*** Putative Vector Insertion (Chr 7: 150255756 - 150255840) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000368056 Chr7:150255841..150256992 TGAAGCTGCCATTGTCACTC Chr7:150256222..150256241 59.99 50
downstream ENSMUSE00000667983 Chr7:150255841..150256197 GAGGGAGACGGTGTCAGAAG Chr7:150255942..150255961 59.83 60
downstream ENSMUSE00000667982 Chr7:150256697..150256992 AAACCAACAGCCTTCACACC Chr7:150256727..150256746 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGGATGAGGCCTTAAAT Chr7:150255784..150255804 59.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGGGATGAGGCCTTAAAT Chr7:150255784..150255804 59.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045752