Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36115
Trapped Gene
C1qtnf7 (ENSMUSG00000061535)
Vector Insertion
Chr 5: 43907226 - 43993160
Public Clones IST11842G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000653692 (Chr5:43906827..43907225 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACGGTTGCAGAACTTCGT Chr5:43907007..43907026 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000653692 (Chr5:43906827..43907225 +)
Downstram Exon
ENSMUSE00000710498 (Chr5:43993161..43993221 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACGGTTGCAGAACTTCGT Chr5:43907007..43907026 59.91 50 TGTTCTGGGAGGGTAGGTTG Chr5:43993222..43993241 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653692 Chr5:43906827..43907225 AGACGGTTGCAGAACTTCGT Chr5:43907007..43907026 59.91 50

*** Putative Vector Insertion (Chr 5: 43907226 - 43993160) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710498 Chr5:43993161..43993221 TGTTCTGGGAGGGTAGGTTG Chr5:43993222..43993241 59.96 55
downstream ENSMUSE00000487218 Chr5:44000292..44000537 CGTCACGTAGAGCAGGACAA Chr5:44000326..44000345 60.05 55
downstream ENSMUSE00000709536 Chr5:44000292..44000537 CGTCACGTAGAGCAGGACAA Chr5:44000326..44000345 60.05 55
downstream ENSMUSE00000599861 Chr5:44006859..44010038 TGGCTGCAGGTAGATGACTG Chr5:44007346..44007365 60.01 55
downstream ENSMUSE00000718152 Chr5:44006859..44007825 TGGCTGCAGGTAGATGACTG Chr5:44007346..44007365 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATAATCGCCTTGCAGCAC Chr5:43916274..43916294 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGAAGGACATCTGAACC Chr5:43916189..43916209 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061535