Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36128
Trapped Gene
Snrpc (ENSMUSG00000024217)
Vector Insertion
Chr 17: 27977115 - 27977408
Public Clones IST14673F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000501996 (Chr17:27977067..27977114 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000501996 (Chr17:27977067..27977114 +)
Downstram Exon
ENSMUSE00000499947 (Chr17:27977409..27977451 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000501996 Chr17:27977067..27977114 No primer for this exon

*** Putative Vector Insertion (Chr 17: 27977115 - 27977408) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000499947 Chr17:27977409..27977451 No primer for this exon
downstream ENSMUSE00000139815 Chr17:27979215..27979323 TCTCTTTGTGTTTCCGACCA Chr17:27979263..27979282 59.26 45
downstream ENSMUSE00000139808 Chr17:27982128..27982217 AGGGATCTTCCCTTGTTGAAA Chr17:27982158..27982178 59.93 42.86
downstream ENSMUSE00000139812 Chr17:27984898..27985002 No primer for this exon
downstream ENSMUSE00000383932 Chr17:27988583..27988910 AGAGCTCCTGGTGGAACAGA Chr17:27988766..27988785 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGGTCAGTTGGGTCCTTA Chr17:27977148..27977168 59.82 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGTTGGGTCCTCGTGACT Chr17:27977153..27977173 60.71 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024217