Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36131
Trapped Gene
Ttc21a (ENSMUSG00000032514)
Vector Insertion
Chr 9: 119855930 - 119859718
Public Clones IST11364G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263023 (Chr9:119855737..119855929 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCTGGAGCGCATCTTTAT Chr9:119855776..119855795 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263023 (Chr9:119855737..119855929 +)
Downstram Exon
ENSMUSE00000220386 (Chr9:119859719..119859816 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCTGGAGCGCATCTTTAT Chr9:119855776..119855795 59.81 45 TCAGACTTCCCAAGGGACTG Chr9:119859818..119859837 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000348285 Chr9:119846765..119846868 CAGCGATGACTCCTCTCTCA Chr9:119846847..119846866 59.23 55
upstream ENSMUSE00000263182 Chr9:119848285..119848414 GGGCCTAGAGAGGTACAGCA Chr9:119848347..119848366 59.45 60
upstream ENSMUSE00000220366 Chr9:119849534..119849644 ACAAATCCTGCGACACCATC Chr9:119849624..119849643 60.94 50
upstream ENSMUSE00000220381 Chr9:119850251..119850417 GAAGGAAATTCGCAGGTCAG Chr9:119850285..119850304 59.81 50
upstream ENSMUSE00000220380 Chr9:119851690..119851812 GGGTGGACCTTACCTCCAGT Chr9:119851709..119851728 60.23 60
upstream ENSMUSE00000220374 Chr9:119852935..119853092 AACTTCCTGCCCGCTTTAGT Chr9:119853010..119853029 60.26 50
upstream ENSMUSE00000220371 Chr9:119854063..119854147 GAAAGAAGGGAACACGGACA Chr9:119854126..119854145 60.09 50
upstream ENSMUSE00000220363 Chr9:119854601..119854699 AAGGCGCTAGAGACTGGAGA Chr9:119854628..119854647 59.33 55
upstream ENSMUSE00000263023 Chr9:119855737..119855929 TTCCTGGAGCGCATCTTTAT Chr9:119855776..119855795 59.81 45

*** Putative Vector Insertion (Chr 9: 119855930 - 119859718) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220386 Chr9:119859719..119859816 TCAGACTTCCCAAGGGACTG Chr9:119859818..119859837 60.23 55
downstream ENSMUSE00000220361 Chr9:119859938..119860138 TCAAAGTACTCGGGGCTCAG Chr9:119860077..119860096 60.39 55
downstream ENSMUSE00000220379 Chr9:119861273..119861402 TCAAGATCATGGCGACTTGT Chr9:119861333..119861352 59.24 45
downstream ENSMUSE00000220372 Chr9:119863274..119863431 ATCTGGGACATGAGGAGGTG Chr9:119863364..119863383 59.92 55
downstream ENSMUSE00000220365 Chr9:119863652..119863867 TTTATGGCCTCGGCATAGTC Chr9:119863731..119863750 60.06 50
downstream ENSMUSE00000220362 Chr9:119865952..119866190 GAACTCATTGATGGCGTCCT Chr9:119865996..119866015 60.08 50
downstream ENSMUSE00000220382 Chr9:119867182..119867254 CATGAAAGCGTCACCCAGTA Chr9:119867245..119867264 59.72 50
downstream ENSMUSE00000262814 Chr9:119867356..119867466 GGTCTTCACGTAGGCCTGTC Chr9:119867454..119867473 59.73 60
downstream ENSMUSE00000262779 Chr9:119867805..119867943 CTGGGCAGCCTCGTAGTAAT Chr9:119867834..119867853 59.36 55
downstream ENSMUSE00000262751 Chr9:119868087..119868193 TTCAGGGTTTCCATCACCTC Chr9:119868192..119868211 59.9 50
downstream ENSMUSE00000262728 Chr9:119870873..119871061 GATGTTCCCCAATCTGGATG Chr9:119870987..119871006 60.13 50
downstream ENSMUSE00000220368 Chr9:119872299..119872409 GCTGACCCAGAAGCAGGTAG Chr9:119872344..119872363 60.01 60
downstream ENSMUSE00000220378 Chr9:119873350..119873431 TGGAGCTTTCTCCAGCACTT Chr9:119873433..119873452 60.13 50
downstream ENSMUSE00000220373 Chr9:119874815..119874965 ACCCGGCTAGACACCTTCTT Chr9:119874923..119874942 60.13 55
downstream ENSMUSE00000220384 Chr9:119875131..119875292 TTCGGGCTTTGTTCAGAAAC Chr9:119875183..119875202 60.23 45
downstream ENSMUSE00000262608 Chr9:119875385..119875577 TCTCGATAAAGGCTCCCAGA Chr9:119875566..119875585 59.91 50
downstream ENSMUSE00000262582 Chr9:119875673..119875897 AAGCCAGCTCTTTTCCAGGT Chr9:119875819..119875838 60.38 50
downstream ENSMUSE00000220364 Chr9:119876314..119876434 CAGCTCGTAGTTGGTTGCTG Chr9:119876400..119876419 59.66 55
downstream ENSMUSE00000220376 Chr9:119876565..119876632 No primer for this exon
downstream ENSMUSE00000262496 Chr9:119876715..119876895 CCTGAACCGTCGTCGTCTAT Chr9:119876856..119876875 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGAAGCTGGAGGAGAAC Chr9:119858892..119858912 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGAAGCTGGAGGAGAAC Chr9:119858892..119858912 59.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032514