Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36135
Trapped Gene
Uaca (ENSMUSG00000034485)
Vector Insertion
Chr 9: 60708967 - 60711197
Public Clones IST12579A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224298 (Chr9:60708859..60708966 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224298 (Chr9:60708859..60708966 +)
Downstram Exon
ENSMUSE00000224278 (Chr9:60711198..60711230 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711869 Chr9:60642355..60642499 CCATGAAGAGCCTCAAGTCC Chr9:60642414..60642433 59.8 55
upstream ENSMUSE00000717750 Chr9:60642355..60642499 CCATGAAGAGCCTCAAGTCC Chr9:60642414..60642433 59.8 55
upstream ENSMUSE00000533259 Chr9:60688647..60688780 GGCAAGCTAGATGTGGAAGG Chr9:60688752..60688771 59.84 55
upstream ENSMUSE00000533276 Chr9:60688647..60688780 GGCAAGCTAGATGTGGAAGG Chr9:60688752..60688771 59.84 55
upstream ENSMUSE00000224468 Chr9:60693800..60693888 CTTACGCATGGCATTGATGT Chr9:60693849..60693868 59.57 45
upstream ENSMUSE00000224446 Chr9:60696429..60696493 GGCAGCTAAGTACGGACACG Chr9:60696448..60696467 60.85 60
upstream ENSMUSE00000224427 Chr9:60697252..60697309 CTGAGCATGTGGACCTTCAA Chr9:60697265..60697284 59.83 50
upstream ENSMUSE00000224403 Chr9:60697937..60698007 AGACTGTCCTTCCAGCATCC Chr9:60697944..60697963 59.26 55
upstream ENSMUSE00000224379 Chr9:60698108..60698214 ACCACTTGTTCTGGCGACTC Chr9:60698119..60698138 60.31 55
upstream ENSMUSE00000224356 Chr9:60702123..60702304 ATGCCGTAGAAGTCCTCGTG Chr9:60702161..60702180 60.28 55
upstream ENSMUSE00000435436 Chr9:60702123..60702310 ATGCCGTAGAAGTCCTCGTG Chr9:60702161..60702180 60.28 55
upstream ENSMUSE00000224335 Chr9:60704005..60704042 GCGAGAACTTTGGAGGAAAG Chr9:60704006..60704025 59.05 50
upstream ENSMUSE00000224316 Chr9:60706947..60707024 GACGAAGGAAGCGTGAAGTC Chr9:60706968..60706987 60 55
upstream ENSMUSE00000224298 Chr9:60708859..60708966 No primer for this exon

*** Putative Vector Insertion (Chr 9: 60708967 - 60711197) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224278 Chr9:60711198..60711230 No primer for this exon
downstream ENSMUSE00000224262 Chr9:60711407..60711505 GCCAAAAGGGACTTCAGCTT Chr9:60711435..60711454 60.74 50
downstream ENSMUSE00000224245 Chr9:60714172..60714208 No primer for this exon
downstream ENSMUSE00000224228 Chr9:60715239..60715291 TGTGGCTCTGTCGTGTACATT Chr9:60715292..60715312 59.23 47.62
downstream ENSMUSE00000372471 Chr9:60717382..60717837 TTGTGAGCCAGTTCGTTTTG Chr9:60717572..60717591 59.88 45
downstream ENSMUSE00000396859 Chr9:60717382..60720090 ACCAGCATCTCGCTCTGTTT Chr9:60717884..60717903 60.02 50
downstream ENSMUSE00000405216 Chr9:60718348..60720090 TCCTGTGCCTCCTTCAGACT Chr9:60718985..60719004 59.99 55
downstream ENSMUSE00000435441 Chr9:60721840..60721992 TGCTGCAGAGTATCCACCAG Chr9:60721964..60721983 60.01 55
downstream ENSMUSE00000435439 Chr9:60724169..60724234 GAGGAGGTGTGTCCGGTAGA Chr9:60724225..60724244 60.11 60
downstream ENSMUSE00000533258 Chr9:60727981..60728177 GCCTTGTCGCATCTGTATGA Chr9:60728043..60728062 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr9:60709016..60709036 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTACGTGACTGGGAAAAC Chr9:60709013..60709033 58.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034485