Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36151
Trapped Gene
AC110164.26 (ENSMUSG00000083610)
Vector Insertion
Chr 3: 135188927 - 135189497
Public Clones IST10381E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714963 (Chr3:135189431..135189496 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGTACCCAGCTCCAGTGC Chr3:135189437..135189456 60.33 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714963 (Chr3:135189431..135189496 -)
Downstram Exon
ENSMUSE00000716962 (Chr3:135188928..135189398 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGTACCCAGCTCCAGTGC Chr3:135189437..135189456 60.33 60 GGAAGTGGACGATGTGAGGT Chr3:135189229..135189248 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714963 Chr3:135189431..135189496 ACTGTACCCAGCTCCAGTGC Chr3:135189437..135189456 60.33 60
upstream ENSMUSE00000716962 Chr3:135188928..135189398 ACCTCACATCGTCCACTTCC Chr3:135189251..135189270 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTACCCTAATCGCCTTGC Chr3:135189434..135189454 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCCACCGAGGATGATAA Chr3:135189488..135189508 59.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000083610