Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36154
Trapped Gene
Dnahc5 (ENSMUSG00000022262)
Vector Insertion
Chr 15: 28368004 - 28373836
Public Clones IST14197A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000259400 (Chr15:28367854..28368003 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGACGCCTCCTTCTGATT Chr15:28367951..28367970 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000259400 (Chr15:28367854..28368003 +)
Downstram Exon
ENSMUSE00000259540 (Chr15:28373837..28374082 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGACGCCTCCTTCTGATT Chr15:28367951..28367970 59.95 50 AGGAGGCAGATGAGTGGTGT Chr15:28373952..28373971 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000467310 Chr15:28133521..28133790 ATGTTTAGGATCGGCAGACG Chr15:28133734..28133753 60.1 50
upstream ENSMUSE00000260313 Chr15:28148850..28148984 GGCGGCATGACTATCTGTTT Chr15:28148896..28148915 60.1 50
upstream ENSMUSE00000260308 Chr15:28153950..28154034 GTTGGTGGACTCCGTCATCT Chr15:28153977..28153996 59.97 55
upstream ENSMUSE00000260302 Chr15:28159254..28159414 GCCATTACGCCTGAGAACAT Chr15:28159388..28159407 60.1 50
upstream ENSMUSE00000260293 Chr15:28160151..28160372 CACGTTAGACACGGCAGATG Chr15:28160165..28160184 60.32 55
upstream ENSMUSE00000488426 Chr15:28162912..28163049 TGAAGGAACCCACGGACTAC Chr15:28162952..28162971 59.97 55
upstream ENSMUSE00000487407 Chr15:28164000..28164176 GCACTGGAAACAAAGGCTCT Chr15:28164065..28164084 59.48 50
upstream ENSMUSE00000490305 Chr15:28165459..28165572 No primer for this exon
upstream ENSMUSE00000489762 Chr15:28166374..28166481 No primer for this exon
upstream ENSMUSE00000480386 Chr15:28168266..28168388 ATCACCAACAATGGGACTGC Chr15:28168302..28168321 60.79 50
upstream ENSMUSE00000479552 Chr15:28169574..28169789 CGACGTCTGGCCAAGATAAT Chr15:28169685..28169704 60.1 50
upstream ENSMUSE00000482407 Chr15:28172412..28172519 TTTTGCAAGCGGATTAATGA Chr15:28172493..28172512 59.29 35
upstream ENSMUSE00000477249 Chr15:28175417..28175502 CAAGCTCTAAGCACGCTGAA Chr15:28175471..28175490 59.51 50
upstream ENSMUSE00000484454 Chr15:28176003..28176324 CCAGAATTTTGCGACTGACA Chr15:28176051..28176070 59.84 45
upstream ENSMUSE00000483570 Chr15:28177526..28177732 AAGCGGGACATGTTCAAAAA Chr15:28177694..28177713 60.48 40
upstream ENSMUSE00000485900 Chr15:28182177..28182348 CCCTGAATATTGGGGGCTAT Chr15:28182304..28182323 60 50
upstream ENSMUSE00000485073 Chr15:28193307..28193452 ATGACCCCCTGACTTGTGAA Chr15:28193412..28193431 60.36 50
upstream ENSMUSE00000503272 Chr15:28199048..28199210 TGCGCAGCTACTCCATTTTA Chr15:28199065..28199084 59.61 45
upstream ENSMUSE00000506060 Chr15:28200049..28200282 GTGTTAGAGGAAGCCCGTGA Chr15:28200150..28200169 60.26 55
upstream ENSMUSE00000505054 Chr15:28201781..28201971 CAAGGGGGTTAGACAGTGGA Chr15:28201932..28201951 59.96 55
upstream ENSMUSE00000499748 Chr15:28202060..28202147 GCTGAGGTGGAGGAAAATGA Chr15:28202120..28202139 60.19 50
upstream ENSMUSE00000500386 Chr15:28208269..28208402 TTACCCATCCCAGTGCAAAC Chr15:28208295..28208314 60.76 50
upstream ENSMUSE00000476717 Chr15:28218809..28219010 ACCGCTTCAAACGCTACAAT Chr15:28218828..28218847 59.78 45
upstream ENSMUSE00000479154 Chr15:28219810..28220045 AGATCTCCACCGACTTCCAA Chr15:28220011..28220030 59.65 50
upstream ENSMUSE00000478250 Chr15:28223331..28223549 GAATGAGTTAGGCGCTCTGC Chr15:28223447..28223466 60.12 55
upstream ENSMUSE00000503967 Chr15:28224673..28224735 GATGGCAAGTGGATTGAAGC Chr15:28224681..28224700 60.61 50
upstream ENSMUSE00000494771 Chr15:28224985..28225223 CCCTTTGGTCAGACGTGAAC Chr15:28225163..28225182 60.54 55
upstream ENSMUSE00000497618 Chr15:28226763..28227003 GAACGACACTGGCAGAGGAT Chr15:28226884..28226903 60.27 55
upstream ENSMUSE00000497027 Chr15:28228836..28229035 AGTGCCGTGAAGGAGAGAGA Chr15:28228848..28228867 60.13 55
upstream ENSMUSE00000492070 Chr15:28232141..28232294 TGACCGTTCAAAACTTGTGG Chr15:28232221..28232240 59.58 45
upstream ENSMUSE00000499370 Chr15:28234341..28234504 ATCTGCCAGAAGTCGCTCAC Chr15:28234482..28234501 60.56 55
upstream ENSMUSE00000495828 Chr15:28236988..28237144 CCATTTGCTGAACGTGTTTG Chr15:28237093..28237112 60.15 45
upstream ENSMUSE00000520540 Chr15:28240894..28241106 TCTCTGCTGGAGGAGTCACA Chr15:28240993..28241012 59.69 55
upstream ENSMUSE00000514837 Chr15:28241914..28242138 TTACCACGAAGGACCTGAGC Chr15:28242047..28242066 60.26 55
upstream ENSMUSE00000493988 Chr15:28243495..28243667 ATGCACGTCAAGAGCCCTAC Chr15:28243501..28243520 60.28 55
upstream ENSMUSE00000519335 Chr15:28256275..28256453 GACTTGGGCGGATATTCAAA Chr15:28256433..28256452 59.9 45
upstream ENSMUSE00000125105 Chr15:28256946..28257133 GCCCAGCAAATCTCCATTAT Chr15:28257020..28257039 59 45
upstream ENSMUSE00000125107 Chr15:28257477..28257671 GCTGCGGCTTCATTGATAAC Chr15:28257589..28257608 60.75 50
upstream ENSMUSE00000472198 Chr15:28261460..28261594 GTCTCCGCAACATTCTGTCA Chr15:28261476..28261495 59.84 50
upstream ENSMUSE00000513798 Chr15:28262780..28262887 TTTTGGACAAGGCAGGCTAT Chr15:28262838..28262857 59.71 45
upstream ENSMUSE00000507360 Chr15:28265323..28265476 CCAGTTGTTTGAAACGCAGA Chr15:28265373..28265392 59.88 45
upstream ENSMUSE00000506413 Chr15:28270036..28270182 CAAACGACTGGACTGATGGA Chr15:28270120..28270139 59.68 50
upstream ENSMUSE00000470330 Chr15:28273190..28273431 CCGTCTCAAGAAATGGGATG Chr15:28273367..28273386 60.45 50
upstream ENSMUSE00000465604 Chr15:28275492..28275668 AGAGACTTTCCCGGACCTGT Chr15:28275548..28275567 60.11 55
upstream ENSMUSE00000464944 Chr15:28276526..28276727 TTTGCCATGATGTGGAGTGT Chr15:28276574..28276593 59.97 45
upstream ENSMUSE00000467698 Chr15:28279528..28279670 AAAACCATTGCCAAACAAGG Chr15:28279647..28279666 59.84 40
upstream ENSMUSE00000474276 Chr15:28280332..28280466 CAAGGGACAGCCAAAACAGT Chr15:28280353..28280372 60.15 50
upstream ENSMUSE00000469548 Chr15:28295293..28295415 GCACGACATATGGTCCTCCT Chr15:28295327..28295346 59.96 55
upstream ENSMUSE00000468546 Chr15:28295899..28296112 CATACCACAGCGCTTGAAGA Chr15:28296033..28296052 60.01 50
upstream ENSMUSE00000471318 Chr15:28297441..28297664 TGATTGGGGCAGGCTACTAC Chr15:28297444..28297463 60.1 55
upstream ENSMUSE00000442735 Chr15:28300110..28300308 AGCTGACCGCTTTAGCATGT Chr15:28300151..28300170 60.04 50
upstream ENSMUSE00000488236 Chr15:28301998..28302170 CAATCGCATCCCTTAACCAC Chr15:28302046..28302065 60.33 50
upstream ENSMUSE00000487067 Chr15:28308086..28308216 AGCTTGACAAGGTTGGCTTC Chr15:28308155..28308174 59.48 50
upstream ENSMUSE00000490087 Chr15:28313331..28313484 ACCTCGAACCTGATGGAAGA Chr15:28313341..28313360 59.65 50
upstream ENSMUSE00000466101 Chr15:28313963..28314230 TCGAAACCGAGCTTTGAAGT Chr15:28314142..28314161 59.99 45
upstream ENSMUSE00000461347 Chr15:28317516..28317747 ACAGCGGAGATCAAGAAGGA Chr15:28317554..28317573 59.95 50
upstream ENSMUSE00000460279 Chr15:28320198..28320312 GCAGCCTTGAGCAAAGAACT Chr15:28320244..28320263 59.76 50
upstream ENSMUSE00000463171 Chr15:28320463..28320639 TTGTCGACAGCATCTCCAAG Chr15:28320548..28320567 59.98 50
upstream ENSMUSE00000481149 Chr15:28326806..28327009 TTTCAGAGGAGGGTCAATGC Chr15:28326896..28326915 60.19 50
upstream ENSMUSE00000480272 Chr15:28331542..28331721 GTAGCCGGACTTTGTTCCTG Chr15:28331647..28331666 59.73 55
upstream ENSMUSE00000486568 Chr15:28333158..28333295 TGGTGCAGGCAGAGTATGAA Chr15:28333255..28333274 60.41 50
upstream ENSMUSE00000477782 Chr15:28338036..28338171 GGACCGGTGTAGGCATAAGA Chr15:28338053..28338072 59.96 55
upstream ENSMUSE00000502356 Chr15:28338739..28339055 CTGGCTACGGCTTTTCTGTC Chr15:28338750..28338769 60.01 55
upstream ENSMUSE00000505515 Chr15:28339601..28339756 TTTGCTCATCGAGGATGTTG Chr15:28339666..28339685 59.8 45
upstream ENSMUSE00000493920 Chr15:28341261..28341443 TAAGTGCTCGGACCTCCATC Chr15:28341352..28341371 60.22 55
upstream ENSMUSE00000492737 Chr15:28349515..28349758 GGGTCTCTGGTGGAAGATGA Chr15:28349620..28349639 60.05 55
upstream ENSMUSE00000519096 Chr15:28350720..28350834 GACTTCGCTCCGTCAGTTTC Chr15:28350787..28350806 60 55
upstream ENSMUSE00000498404 Chr15:28351320..28351510 GCCCAATTACAAGCAAGAGG Chr15:28351331..28351350 59.71 50
upstream ENSMUSE00000491901 Chr15:28365925..28366046 CCTGTCCTCCTAAGCCATCA Chr15:28365949..28365968 60.21 55
upstream ENSMUSE00000259400 Chr15:28367854..28368003 TCAGACGCCTCCTTCTGATT Chr15:28367951..28367970 59.95 50

*** Putative Vector Insertion (Chr 15: 28368004 - 28373836) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000259540 Chr15:28373837..28374082 AGGAGGCAGATGAGTGGTGT Chr15:28373952..28373971 59.71 55
downstream ENSMUSE00000259609 Chr15:28374745..28374964 GGCTCATTGGCAAACTTGAT Chr15:28374926..28374945 60.08 45
downstream ENSMUSE00000259533 Chr15:28378038..28378243 AGGGATATTCCACCCCAGAG Chr15:28378168..28378187 60.15 55
downstream ENSMUSE00000259597 Chr15:28378905..28379108 TCATGTAGCGGACAGTGGTC Chr15:28378938..28378957 59.71 55
downstream ENSMUSE00000259592 Chr15:28381073..28381288 CTGGATGCCCAGGATAGTGT Chr15:28381186..28381205 59.95 55
downstream ENSMUSE00000474691 Chr15:28382956..28383168 GGCTGAGTACCCTCTGCATC Chr15:28383049..28383068 59.83 60
downstream ENSMUSE00000259458 Chr15:28388303..28388455 CTGTCGCATCGCAGTTAAGA Chr15:28388458..28388477 60.16 50
downstream ENSMUSE00000468029 Chr15:28388874..28389105 TGACAGGCATCAGCTCAAAA Chr15:28389084..28389103 60.54 45
downstream ENSMUSE00000473678 Chr15:28400112..28401800 CGGTACAGACCCCACACTTT Chr15:28400875..28400894 59.88 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr15:28371054..28371074 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGCATGATAACGTGACTG Chr15:28371043..28371063 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022262