Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36158
Trapped Gene
OTTMUSG00000011393 (ENSMUSG00000075520)
Vector Insertion
Chr 2: 16063944 - 16072376
Public Clones IST11916E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700320 (Chr2:16063818..16063943 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGATGGTACTGCCCACTG Chr2:16063889..16063908 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700320 (Chr2:16063818..16063943 +)
Downstram Exon
ENSMUSE00000700319 (Chr2:16072377..16072432 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGATGGTACTGCCCACTG Chr2:16063889..16063908 60.59 55 GTGCCACCATTTCTGCAATA Chr2:16072413..16072432 59.55 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000647412 Chr2:15963753..15963909 GATTGGAGCATCGGTAGCAT Chr2:15963846..15963865 60.07 50
upstream ENSMUSE00000647411 Chr2:15996319..15996476 TGGACGGCATTTCTTGTATG Chr2:15996323..15996342 59.54 45
upstream ENSMUSE00000647410 Chr2:16023382..16023583 CAGTCCCTTCAAGGTTGCAT Chr2:16023483..16023502 60.11 50
upstream ENSMUSE00000700321 Chr2:16049475..16049738 GAGTGGCTGATTGCCAATTT Chr2:16049697..16049716 60.08 45
upstream ENSMUSE00000700320 Chr2:16063818..16063943 TGTGATGGTACTGCCCACTG Chr2:16063889..16063908 60.59 55

*** Putative Vector Insertion (Chr 2: 16063944 - 16072376) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700319 Chr2:16072377..16072432 GTGCCACCATTTCTGCAATA Chr2:16072413..16072432 59.55 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr2:16063992..16064012 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCAAACCACCTTTCCTCCA Chr2:16063957..16063977 60.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075520