Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36164
Trapped Gene
Dennd1a (ENSMUSG00000035392)
Vector Insertion
Chr 2: 37672435 - 37700321
Public Clones IST12353D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000603304 (Chr2:37700297..37700320 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000603304 (Chr2:37700297..37700320 -)
Downstram Exon
ENSMUSE00000645536 (Chr2:37672436..37672524 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTTGGGTCTCCTGACGACAT Chr2:37672464..37672483 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715569 Chr2:38142633..38142867 CGGCTGGAGCGAGTACTTTA Chr2:38142839..38142858 60.53 55
upstream ENSMUSE00000719732 Chr2:38142633..38142867 CGGCTGGAGCGAGTACTTTA Chr2:38142839..38142858 60.53 55
upstream ENSMUSE00000603315 Chr2:38098922..38098992 TCCTAGGACAGGTGGCACTC Chr2:38098928..38098947 60.26 60
upstream ENSMUSE00000662608 Chr2:38098922..38098992 TCCTAGGACAGGTGGCACTC Chr2:38098928..38098947 60.26 60
upstream ENSMUSE00000567430 Chr2:38015327..38015370 AGAGGCAATTCCCAGAGGAC Chr2:38015339..38015358 60.6 55
upstream ENSMUSE00000603314 Chr2:38015327..38015370 AGAGGCAATTCCCAGAGGAC Chr2:38015339..38015358 60.6 55
upstream ENSMUSE00000567429 Chr2:37992446..37992495 No primer for this exon
upstream ENSMUSE00000693591 Chr2:37992446..37992495 No primer for this exon
upstream ENSMUSE00000254197 Chr2:37982049..37982168 CTGCCGCTTATCTTCAGGAG Chr2:37982074..37982093 60.11 55
upstream ENSMUSE00000693590 Chr2:37982049..37982168 CTGCCGCTTATCTTCAGGAG Chr2:37982074..37982093 60.11 55
upstream ENSMUSE00000603295 Chr2:37904245..37904314 CTTGGCAGATTACACGACGA Chr2:37904253..37904272 59.86 50
upstream ENSMUSE00000645543 Chr2:37904245..37904314 CTTGGCAGATTACACGACGA Chr2:37904253..37904272 59.86 50
upstream ENSMUSE00000645542 Chr2:37898859..37898939 TCCCTGATCCTGGAGTGTCT Chr2:37898874..37898893 59.64 55
upstream ENSMUSE00000693589 Chr2:37898859..37898939 TCCCTGATCCTGGAGTGTCT Chr2:37898874..37898893 59.64 55
upstream ENSMUSE00000645541 Chr2:37894672..37894725 TGTGCCTGATAGCAGAGAGC Chr2:37894692..37894711 59.3 55
upstream ENSMUSE00000693588 Chr2:37894672..37894725 TGTGCCTGATAGCAGAGAGC Chr2:37894692..37894711 59.3 55
upstream ENSMUSE00000645540 Chr2:37876876..37876986 TCATCATCTGCAGCAAGCTC Chr2:37876882..37876901 60.26 50
upstream ENSMUSE00000693587 Chr2:37876876..37876986 TCATCATCTGCAGCAAGCTC Chr2:37876882..37876901 60.26 50
upstream ENSMUSE00000645539 Chr2:37858894..37858994 GCATGTGTACATCCCTGTGC Chr2:37858922..37858941 60 55
upstream ENSMUSE00000693586 Chr2:37858894..37858994 GCATGTGTACATCCCTGTGC Chr2:37858922..37858941 60 55
upstream ENSMUSE00000645538 Chr2:37838580..37838625 TCCCATGCCCTACCTCATAG Chr2:37838603..37838622 59.91 55
upstream ENSMUSE00000693585 Chr2:37838580..37838625 TCCCATGCCCTACCTCATAG Chr2:37838603..37838622 59.91 55
upstream ENSMUSE00000567423 Chr2:37817161..37817262 CCCTTTTGATGACCTCCAGA Chr2:37817178..37817197 60.04 50
upstream ENSMUSE00000645537 Chr2:37817161..37817262 CCCTTTTGATGACCTCCAGA Chr2:37817178..37817197 60.04 50
upstream ENSMUSE00000254146 Chr2:37792139..37792264 CGGAATGCACTGAAAATTGA Chr2:37792143..37792162 59.66 40
upstream ENSMUSE00000603306 Chr2:37792139..37792264 CGGAATGCACTGAAAATTGA Chr2:37792143..37792162 59.66 40
upstream ENSMUSE00000693592 Chr2:37772362..37772365 No primer for this exon
upstream ENSMUSE00000254141 Chr2:37713888..37713992 GTATCCCACTACCGCTCTGG Chr2:37713940..37713959 59.57 60
upstream ENSMUSE00000693584 Chr2:37713888..37713992 GTATCCCACTACCGCTCTGG Chr2:37713940..37713959 59.57 60
upstream ENSMUSE00000254133 Chr2:37713538..37713625 GACCTTCTCAATTCCGGTGA Chr2:37713588..37713607 60.05 50
upstream ENSMUSE00000693583 Chr2:37713538..37713625 GACCTTCTCAATTCCGGTGA Chr2:37713588..37713607 60.05 50
upstream ENSMUSE00000254126 Chr2:37711636..37711676 GTACCATCAGTGGCTGTCCA Chr2:37711644..37711663 59.55 55
upstream ENSMUSE00000693582 Chr2:37711636..37711676 GTACCATCAGTGGCTGTCCA Chr2:37711644..37711663 59.55 55
upstream ENSMUSE00000254119 Chr2:37709513..37709584 AAGGAAGTGGTGCGATTCTG Chr2:37709564..37709583 60.26 50
upstream ENSMUSE00000693581 Chr2:37709513..37709584 AAGGAAGTGGTGCGATTCTG Chr2:37709564..37709583 60.26 50
upstream ENSMUSE00000567428 Chr2:37707916..37707972 AAAAACCGCTTGAAGCAAAA Chr2:37707917..37707936 59.87 35
upstream ENSMUSE00000603305 Chr2:37700325..37700359 No primer for this exon
upstream ENSMUSE00000254241 Chr2:37700297..37700428 ACCGGAGACCAATCACAGTC Chr2:37700309..37700328 59.97 55
upstream ENSMUSE00000603304 Chr2:37700297..37700320 No primer for this exon
upstream ENSMUSE00000645536 Chr2:37672436..37672524 ATGTCGTCAGGAGACCCAAG Chr2:37672486..37672505 60.11 55

*** Putative Vector Insertion (Chr 2: 37672435 - 37700321) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693580 Chr2:37660592..37660720 CATAGTGTCGCAAGGGCTTT Chr2:37660673..37660692 60.27 50
downstream ENSMUSE00000645535 Chr2:37657535..37657793 GGACTCTCGGTCTCATCACC Chr2:37657709..37657728 59.64 60
downstream ENSMUSE00000693594 Chr2:37654514..37656770 CGAGAGCCCAGAGGTATGAG Chr2:37654904..37654923 59.97 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCACTTCCCCAGTGTCAA Chr2:37697276..37697296 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAACGTGACTGGGAAAAC Chr2:37697255..37697275 59.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035392