Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36165
Trapped Gene
Zfp820 (ENSMUSG00000069743)
Vector Insertion
Chr 17: 21977571 - 21982740
Public Clones IST14616G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000382705 (Chr17:21982611..21982739 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGGCCCTGGAAAAGTCT Chr17:21982704..21982723 60.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000382705 (Chr17:21982611..21982739 -)
Downstram Exon
ENSMUSE00000658145 (Chr17:21977572..21977681 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGGCCCTGGAAAAGTCT Chr17:21982704..21982723 60.76 55 ATCCGGGGCTCTTAGTTCTG Chr17:21977602..21977621 60.59 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382705 Chr17:21982611..21982739 CTCTGGCCCTGGAAAAGTCT Chr17:21982704..21982723 60.76 55
upstream ENSMUSE00000658145 Chr17:21977572..21977681 AGAACTAAGAGCCCCGGATG Chr17:21977623..21977642 60.59 55

*** Putative Vector Insertion (Chr 17: 21977571 - 21982740) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658144 Chr17:21960811..21960858 No primer for this exon
downstream ENSMUSE00000524059 Chr17:21958037..21958163 CCATGTACAGTGCCCTCTGA Chr17:21958054..21958073 59.7 55
downstream ENSMUSE00000658143 Chr17:21954847..21957155 TTAAGACGGCTTTTGCTGGT Chr17:21956023..21956042 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCCAACTAATCGCCTTGC Chr17:21979677..21979697 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCTGAGAAGCAGTCGTGA Chr17:21979684..21979704 59.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069743