Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36179
Trapped Gene
Ick (ENSMUSG00000079454)
Vector Insertion
Chr 9: 77961263 - 77972762
Public Clones IST14641H1 (tigm) IST11558A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712597 (Chr9:77961122..77961262 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712597 (Chr9:77961122..77961262 +)
Downstram Exon
ENSMUSE00000218948 (Chr9:77972763..77972954 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGCTCAGGGAGCCATTTTCT Chr9:77972806..77972825 60.35 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712597 Chr9:77961122..77961262 No primer for this exon

*** Putative Vector Insertion (Chr 9: 77961263 - 77972762) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218948 Chr9:77972763..77972954 AGCTCAGGGAGCCATTTTCT Chr9:77972806..77972825 60.35 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:77964313..77964333 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAATTGAGATCCAACTGAACA Chr9:77964277..77964299 59.03 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079454