Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36186
Trapped Gene
Ptprt (ENSMUSG00000053141)
Vector Insertion
Chr 2: 161637670 - 161727294
Public Clones IST13844F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000551832 (Chr2:161727184..161727293 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACCTCCCAATGAGACCA Chr2:161727207..161727226 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000551832 (Chr2:161727184..161727293 -)
Downstram Exon
ENSMUSE00000471309 (Chr2:161637671..161637872 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACCTCCCAATGAGACCA Chr2:161727207..161727226 59.9 50 AGACCCACAAAGAGGTGGTG Chr2:161637744..161637763 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639389 Chr2:162486536..162486635 No primer for this exon
upstream ENSMUSE00000680320 Chr2:162486536..162486830 No primer for this exon
upstream ENSMUSE00000680322 Chr2:162486536..162486883 GTTAGGACTCTGGGGACACC Chr2:162486864..162486883 58.44 60
upstream ENSMUSE00000477533 Chr2:162188637..162188762 TATAGCGTGGCTCTGGGAAC Chr2:162188705..162188724 60.24 55
upstream ENSMUSE00000478427 Chr2:162103784..162104055 TATCTGGCGTCGTCACTGAG Chr2:162103838..162103857 60.01 55
upstream ENSMUSE00000680309 Chr2:162103784..162104056 TATCTGGCGTCGTCACTGAG Chr2:162103838..162103857 60.01 55
upstream ENSMUSE00000475970 Chr2:162093724..162093805 GTTACATCGCTGTGGACGAA Chr2:162093749..162093768 59.72 50
upstream ENSMUSE00000476916 Chr2:162079489..162079604 ATTGCTGGTGGAAAGTGGTC Chr2:162079514..162079533 59.97 50
upstream ENSMUSE00000473982 Chr2:162063743..162063917 AGATGGTGGGTCTGGTGTGT Chr2:162063770..162063789 60.29 55
upstream ENSMUSE00000474868 Chr2:161960948..161961241 AGTATGAGATCCGGGTGCTG Chr2:161961018..161961037 60.1 55
upstream ENSMUSE00000473384 Chr2:161753218..161753514 GCCACAGCTACAACCTCACA Chr2:161753399..161753418 59.9 55
upstream ENSMUSE00000551832 Chr2:161727184..161727293 GAAACCTCCCAATGAGACCA Chr2:161727207..161727226 59.9 50
upstream ENSMUSE00000471309 Chr2:161637671..161637872 CACCACCTCTTTGTGGGTCT Chr2:161637766..161637785 60 55

*** Putative Vector Insertion (Chr 2: 161637670 - 161727294) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000468357 Chr2:161636286..161636388 GAGTGGGGTATCTGCGTCAT Chr2:161636329..161636348 59.96 55
downstream ENSMUSE00000469779 Chr2:161591960..161592233 GTAGCGAATCGAGGTTGGAG Chr2:161592093..161592112 59.84 55
downstream ENSMUSE00000466895 Chr2:161558615..161558651 CTTTTGTAGCCAGACGCACA Chr2:161558593..161558612 60.05 50
downstream ENSMUSE00000680307 Chr2:161549483..161549485 No primer for this exon
downstream ENSMUSE00000513039 Chr2:161544091..161544147 TGAGGAGGCAGAGTGGAGTC Chr2:161544075..161544094 60.55 60
downstream ENSMUSE00000467692 Chr2:161523710..161523845 AGCCATCTTCACCGTGTTGT Chr2:161523756..161523775 60.58 50
downstream ENSMUSE00000680324 Chr2:161512805..161512834 No primer for this exon
downstream ENSMUSE00000464816 Chr2:161481878..161482026 CATCCTGAGAGCTGGAGGAG Chr2:161481868..161481887 60.09 60
downstream ENSMUSE00000680323 Chr2:161481878..161482035 CATCCTGAGAGCTGGAGGAG Chr2:161481868..161481887 60.09 60
downstream ENSMUSE00000497837 Chr2:161432994..161433184 GAATGGTGAGGGTAGGCTGA Chr2:161433118..161433137 60.07 55
downstream ENSMUSE00000494879 Chr2:161413283..161413370 GTCCCACGAAGCTGTCTGTC Chr2:161413316..161413335 60.87 60
downstream ENSMUSE00000496464 Chr2:161401462..161401538 GAGTGAGGGTCTCCATCCAG Chr2:161401468..161401487 59.64 60
downstream ENSMUSE00000551818 Chr2:161391861..161391897 No primer for this exon
downstream ENSMUSE00000551816 Chr2:161390363..161390460 TTTGTGACCATGACGATGCT Chr2:161390360..161390379 60.12 45
downstream ENSMUSE00000680318 Chr2:161386665..161386724 GGCAGTTCCCACAGTGTGTT Chr2:161386673..161386692 61.03 55
downstream ENSMUSE00000491792 Chr2:161385905..161386021 GGCCAGTATCGGACACACTT Chr2:161385977..161385996 60 55
downstream ENSMUSE00000551815 Chr2:161384556..161384710 CTGGGGGATTGAGAAACTTG Chr2:161384562..161384581 59.52 50
downstream ENSMUSE00000490238 Chr2:161381150..161381285 ATGGTGTCAATCGCAATGAA Chr2:161381219..161381238 59.93 40
downstream ENSMUSE00000487212 Chr2:161379466..161379615 ATCTGGCTGGAGTTGGTCTG Chr2:161379460..161379479 60.26 55
downstream ENSMUSE00000488094 Chr2:161377483..161377656 GCACTCGAGGTGTCACAATG Chr2:161377607..161377626 60.32 55
downstream ENSMUSE00000551812 Chr2:161373020..161373151 ACCGTGTTGGGTAGAGGATG Chr2:161373074..161373093 59.84 55
downstream ENSMUSE00000483808 Chr2:161360205..161360330 CCTGGATGGGACCATAACAC Chr2:161360254..161360273 60.05 55
downstream ENSMUSE00000484671 Chr2:161359217..161359380 CCTCTCTTCCGTCGTATTGC Chr2:161359217..161359236 59.84 55
downstream ENSMUSE00000481807 Chr2:161356173..161356308 AGCACAGAAGGTTCCACTGC Chr2:161356253..161356272 60.45 55
downstream ENSMUSE00000513963 Chr2:161355252..161355305 AAATATTCCAGTGCCACCTCA Chr2:161355243..161355263 59.44 42.86
downstream ENSMUSE00000680313 Chr2:161353245..161355305 CTTGTAGCCTGAGGGAGCAC Chr2:161353515..161353534 60.01 60
downstream ENSMUSE00000680319 Chr2:161352093..161355305 CGGTGCCATTACCTGTCTTT Chr2:161353777..161353796 59.99 50
downstream ENSMUSE00000680321 Chr2:161347726..161355305 CGGTGCCATTACCTGTCTTT Chr2:161353777..161353796 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTTGTTGGGGGTTAATCG Chr2:161727237..161727257 60.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTATACAAGTTCCCACGTGACTG Chr2:161652235..161652259 59.98 45.83 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053141