Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36191
Trapped Gene
Pcdh9 (ENSMUSG00000055421)
Vector Insertion
Chr 14: 93414730 - 93726100
Public Clones IST10322H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503467 (Chr14:93725898..93726099 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCTCTTCCTCTGGTTCA Chr14:93725975..93725994 60.23 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503467 (Chr14:93725898..93726099 -)
Downstram Exon
ENSMUSE00000480144 (Chr14:93414731..93415104 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCTCTTCCTCTGGTTCA Chr14:93725975..93725994 60.23 55 CGGTCATTGAATTGGTTCCT Chr14:93414839..93414858 59.79 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447478 Chr14:94284916..94287951 CCCATCAATGGGACCATAAG Chr14:94285238..94285257 60.01 50
upstream ENSMUSE00000685527 Chr14:94284916..94285443 CCCATCAATGGGACCATAAG Chr14:94285238..94285257 60.01 50
upstream ENSMUSE00000685528 Chr14:93959695..93959796 CAGAAATGTCCCGGCTCTAC Chr14:93959735..93959754 59.69 55
upstream ENSMUSE00000503467 Chr14:93725898..93726099 CACCCTCTTCCTCTGGTTCA Chr14:93725975..93725994 60.23 55
upstream ENSMUSE00000480144 Chr14:93414731..93415104 GCTTGGGTCCATACCAACAC Chr14:93414986..93415005 60.24 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGGAAGAAGCGAAGAGG Chr14:93540127..93540147 59.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr14:93540033..93540053 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055421