Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36210
Trapped Gene
Rit2 (ENSMUSG00000057455)
Vector Insertion
Chr 18: 31132776 - 31313551
Public Clones CMHD-GT_234E3-3 (cmhd) IST10765D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471880 (Chr18:31313359..31313550 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCTTGTGCTAGTGGGTAA Chr18:31313387..31313406 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471880 (Chr18:31313359..31313550 -)
Downstram Exon
ENSMUSE00000625601 (Chr18:31132777..31135158 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCTTGTGCTAGTGGGTAA Chr18:31313387..31313406 59.99 55 GATTCATTGAGAGGGGCAAA Chr18:31134146..31134165 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479250 Chr18:31476495..31476620 GCGGGTCCAGAGAGTACAAG Chr18:31476532..31476551 59.87 60
upstream ENSMUSE00000487874 Chr18:31402775..31402831 GGACTATCACGACCCCACAA Chr18:31402778..31402797 60.78 55
upstream ENSMUSE00000140328 Chr18:31372312..31372385 AAAACCCAGGTGAGGATTGA Chr18:31372355..31372374 59.38 45
upstream ENSMUSE00000471880 Chr18:31313359..31313550 CCCCTTGTGCTAGTGGGTAA Chr18:31313387..31313406 59.99 55
upstream ENSMUSE00000625601 Chr18:31132777..31135158 TTTGCCCCTCTCAATGAATC Chr18:31134168..31134187 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTTTGATTAATCGCCTTGC Chr18:31268488..31268509 59.73 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr18:31187484..31187504 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAAACCCTGAGCTGGCTGTA Chr18:31187305..31187325 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTACGTGACTGGGAAAACC Chr18:31268291..31268311 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057455