Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36217
Trapped Gene
Slco1a1 (ENSMUSG00000041698)
Vector Insertion
Chr 6: 141871486 - 141873022
Public Clones IST12055D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000495336 (Chr6:141872857..141873021 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTCTTGCCCAAATACCTG Chr6:141872903..141872922 59.56 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000495336 (Chr6:141872857..141873021 -)
Downstram Exon
ENSMUSE00000496236 (Chr6:141871487..141871682 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTCTTGCCCAAATACCTG Chr6:141872903..141872922 59.56 50 CAAGGCATACTGGAGGCAAG Chr6:141871631..141871650 60.79 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462825 Chr6:141895100..141895316 TTGCAACACAAGAAGGCAGA Chr6:141895118..141895137 60.57 45
upstream ENSMUSE00000546542 Chr6:141891904..141892045 TGTGCATACCTAGCCAAATCA Chr6:141892004..141892024 59.2 42.86
upstream ENSMUSE00000546537 Chr6:141888484..141888616 AATGGCATCACCTCATTTCC Chr6:141888494..141888513 59.76 45
upstream ENSMUSE00000505301 Chr6:141884921..141885027 ACCTTAAAGCCAACGCAAGA Chr6:141884929..141884948 59.88 45
upstream ENSMUSE00000491139 Chr6:141884337..141884483 TATGCGTGGAATTGGTGAAA Chr6:141884409..141884428 59.93 40
upstream ENSMUSE00000492066 Chr6:141880947..141881045 GAAGATTGTTGGCCCGATTA Chr6:141881010..141881029 59.9 45
upstream ENSMUSE00000546529 Chr6:141874050..141874271 ATTGGCTTTTTGGTCTGTGC Chr6:141874202..141874221 60.12 45
upstream ENSMUSE00000495336 Chr6:141872857..141873021 CCTTCTTGCCCAAATACCTG Chr6:141872903..141872922 59.56 50
upstream ENSMUSE00000496236 Chr6:141871487..141871682 GCATTTGGCCTGTCCTTATC Chr6:141871568..141871587 59.53 50

*** Putative Vector Insertion (Chr 6: 141871486 - 141873022) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000497121 Chr6:141870290..141870455 TCCCCATATAGAGGGTGCTG Chr6:141870410..141870429 59.91 55
downstream ENSMUSE00000546519 Chr6:141866984..141867156 ATGGCTGCGAGTGAGAAGAT Chr6:141866986..141867005 59.98 50
downstream ENSMUSE00000546517 Chr6:141861937..141862001 No primer for this exon
downstream ENSMUSE00000546514 Chr6:141860332..141860449 AGCGCCAAAGTAAACAGGTG Chr6:141860396..141860415 60.31 50
downstream ENSMUSE00000546508 Chr6:141856374..141857651 ATCTGTGCACTCGCTTTCCT Chr6:141857464..141857483 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGAGCCTCTGCTGCAATC Chr6:141872984..141873004 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGAGCCTCTGCTGCAATC Chr6:141872984..141873004 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041698