Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36246
Trapped Gene
1700102P08Rik (ENSMUSG00000032611)
Vector Insertion
Chr 9: 108295191 - 108295565
Public Clones IST13042E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221542 (Chr9:108295165..108295190 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221542 (Chr9:108295165..108295190 +)
Downstram Exon
ENSMUSE00000221541 (Chr9:108295566..108295970 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTTCAAAGGCTCGGTCTA Chr9:108295638..108295657 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221542 Chr9:108295165..108295190 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108295191 - 108295565) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221541 Chr9:108295566..108295970 TCCTTCAAAGGCTCGGTCTA Chr9:108295638..108295657 59.95 50
downstream ENSMUSE00000243784 Chr9:108297625..108297716 TCCTTTGTGACCTCTTGGCTA Chr9:108297701..108297721 59.86 47.62
downstream ENSMUSE00000221540 Chr9:108299524..108300096 AAGGGTGAATCTTGGCAGTG Chr9:108299623..108299642 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCATAGTTTGGGGTAAT Chr9:108295226..108295246 59.16 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000032611