Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3626
Trapped Gene
Adat1 (ENSMUSG00000031949)
Vector Insertion
Chr 8: 114502039 - 114503198
Public Clones BC0140 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000305933 (Chr8:114503199..114503344 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGCACAGGAAAAGAGGTG Chr8:114503232..114503251 60.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000305933 (Chr8:114503199..114503344 -)
Downstram Exon
ENSMUSE00000305928 (Chr8:114501939..114502038 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGCACAGGAAAAGAGGTG Chr8:114503232..114503251 60.69 55 TGTAACATCCAAGGGCTGCT Chr8:114501973..114501992 60.66 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000579926 Chr8:114516081..114516148 CGCGTGGATAATAGGGTGTG Chr8:114516106..114516125 61.29 55
upstream ENSMUSE00000579925 Chr8:114514105..114514312 CCAAATCGTGAGTGGACCTT Chr8:114514176..114514195 59.97 50
upstream ENSMUSE00000710691 Chr8:114514105..114514312 CCAAATCGTGAGTGGACCTT Chr8:114514176..114514195 59.97 50
upstream ENSMUSE00000214910 Chr8:114513751..114513819 AAATGCATAGGCCAGTCCAA Chr8:114513765..114513784 60.47 45
upstream ENSMUSE00000214905 Chr8:114511723..114511777 AGCCAGAAGGAGTTTCCAGA Chr8:114511724..114511743 59.01 50
upstream ENSMUSE00000214909 Chr8:114511022..114511152 AAGAGGACTGTGGAGGCTCA Chr8:114511064..114511083 59.99 55
upstream ENSMUSE00000214907 Chr8:114506062..114506665 GGTGGGGCTACTTCGTGTAA Chr8:114506246..114506265 59.99 55
upstream ENSMUSE00000305933 Chr8:114503199..114503344 GGTGCACAGGAAAAGAGGTG Chr8:114503232..114503251 60.69 55

*** Putative Vector Insertion (Chr 8: 114502039 - 114503198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000305928 Chr8:114501939..114502038 TGTAACATCCAAGGGCTGCT Chr8:114501973..114501992 60.66 50
downstream ENSMUSE00000466491 Chr8:114496005..114496091 AGTCTGGCTGCTCGTCATCT Chr8:114495990..114496009 60.17 55
downstream ENSMUSE00000706274 Chr8:114495453..114496091 GCCAACCTGAGCAATGAGAT Chr8:114495725..114495744 60.23 50
downstream ENSMUSE00000719492 Chr8:114495453..114496062 GCCAACCTGAGCAATGAGAT Chr8:114495725..114495744 60.23 50
downstream ENSMUSE00000467515 Chr8:114492306..114492444 GTAGTCGGGTGGGTTTCTGA Chr8:114492299..114492318 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTACCCTGGAGCATCACAGA Chr8:114503154..114503174 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACCCTGGAGCATCACAGA Chr8:114503154..114503174 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031949