Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36279
Trapped Gene
Ralyl (ENSMUSG00000039717)
Vector Insertion
Chr 3: 14039790 - 14081207
Public Clones IST14568D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676522 (Chr3:14039714..14039789 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTACAGACCAAAGCCTGGA Chr3:14039741..14039760 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676522 (Chr3:14039714..14039789 +)
Downstram Exon
ENSMUSE00000362942 (Chr3:14081208..14081240 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTACAGACCAAAGCCTGGA Chr3:14039741..14039760 60.25 55 ATGGCTCCTTTGATTCAAGC Chr3:14081230..14081249 59.27 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487654 Chr3:13776848..13777103 AAATCGTTGGCTGCTCTGTT Chr3:13776987..13777006 59.88 45
upstream ENSMUSE00000676524 Chr3:13777297..13777307 No primer for this exon
upstream ENSMUSE00000676523 Chr3:13946395..13946532 GTCTCCGTGGTCAAACCAAT Chr3:13946442..13946461 59.83 50
upstream ENSMUSE00000306692 Chr3:14039714..14039789 CCTACAGACCAAAGCCTGGA Chr3:14039741..14039760 60.25 55
upstream ENSMUSE00000676522 Chr3:14039714..14039789 CCTACAGACCAAAGCCTGGA Chr3:14039741..14039760 60.25 55

*** Putative Vector Insertion (Chr 3: 14039790 - 14081207) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362942 Chr3:14081208..14081240 ATGGCTCCTTTGATTCAAGC Chr3:14081230..14081249 59.27 45
downstream ENSMUSE00000410979 Chr3:14107219..14107266 No primer for this exon
downstream ENSMUSE00000306688 Chr3:14115693..14115856 GGTACACGGCCATGGTAATC Chr3:14115722..14115741 60.08 55
downstream ENSMUSE00000306682 Chr3:14129558..14129671 GCCTTTTGCTGCTTCTCAAT Chr3:14129666..14129685 59.6 45
downstream ENSMUSE00000378872 Chr3:14143274..14143446 ATCAGCTTCTTGCCCTCCTT Chr3:14143389..14143408 60.35 50
downstream ENSMUSE00000676520 Chr3:14143949..14143963 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr3:14063838..14063858 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGTGGTTGCTCCAAAGAA Chr3:14063759..14063779 58.7 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039717