Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3628
Trapped Gene
Cdc2l5 (ENSMUSG00000041297)
Vector Insertion
Chr 13: 17820018 - 17830750
Public Clones BC0124 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000325249 (Chr13:17830751..17830828 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAAACCAGGAACTTGCAC Chr13:17830767..17830786 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000325249 (Chr13:17830751..17830828 -)
Downstram Exon
ENSMUSE00000348664 (Chr13:17819901..17820017 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAAACCAGGAACTTGCAC Chr13:17830767..17830786 60.3 50 TTAACTTCCGCCGATATTGC Chr13:17819895..17819914 60.06 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000438720 Chr13:17895272..17896836 TGGTGGAGTACGAGGATGTG Chr13:17896039..17896058 59.54 55
upstream ENSMUSE00000325294 Chr13:17864135..17864791 GCAGCATGTGGCTTTAGTGA Chr13:17864196..17864215 60.02 50
upstream ENSMUSE00000325285 Chr13:17858270..17858440 AACTCCGATGTCTGCTTGCT Chr13:17858371..17858390 60.02 50
upstream ENSMUSE00000571716 Chr13:17856788..17856927 AATATGTGGGCCTCGCTATG Chr13:17856908..17856927 59.94 50
upstream ENSMUSE00000325269 Chr13:17854938..17855108 GGGTTTCCCAATTACAGCAA Chr13:17855043..17855062 59.8 45
upstream ENSMUSE00000571715 Chr13:17843505..17843694 CTCATGGAAGGCCTGGATTA Chr13:17843568..17843587 60.03 50
upstream ENSMUSE00000325259 Chr13:17842091..17842147 TTGCAGATTTTGGACTTGCTC Chr13:17842113..17842133 60.38 42.86
upstream ENSMUSE00000571714 Chr13:17830925..17831026 TGTGGTATCGTCCACCTGAA Chr13:17830978..17830997 59.96 50
upstream ENSMUSE00000325249 Chr13:17830751..17830828 AGCAAACCAGGAACTTGCAC Chr13:17830767..17830786 60.3 50

*** Putative Vector Insertion (Chr 13: 17820018 - 17830750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348664 Chr13:17819901..17820017 TTAACTTCCGCCGATATTGC Chr13:17819895..17819914 60.06 45
downstream ENSMUSE00000325237 Chr13:17818954..17819085 TCTCGCAGGAACTCACACTG Chr13:17818962..17818981 60.18 55
downstream ENSMUSE00000401768 Chr13:17812922..17813127 TCCTAGGGGCTTTGATTGTG Chr13:17813002..17813021 60.07 50
downstream ENSMUSE00000363800 Chr13:17811190..17811639 TTCCACTTTAGGCTGGATGG Chr13:17811343..17811362 60.07 50
downstream ENSMUSE00000571705 Chr13:17807568..17810745 AACTGGTGGTGGTTCAGGAG Chr13:17810602..17810621 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGCTGGTGACATCCATTGT Chr13:17830724..17830744 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCTGGTGACATCCATTGT Chr13:17830724..17830744 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041297