Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36283
Trapped Gene
Sec63 (ENSMUSG00000019802)
Vector Insertion
Chr 10: 42537889 - 42543686
Public Clones IST14283F6 (tigm) IST12417A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666418 (Chr10:42537734..42537888 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAGTGGTATCCCGAACAT Chr10:42537856..42537875 60.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666418 (Chr10:42537734..42537888 +)
Downstram Exon
ENSMUSE00000295767 (Chr10:42543687..42543785 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAGTGGTATCCCGAACAT Chr10:42537856..42537875 60.19 50 GCCACCACCACTCTTGTTTT Chr10:42543711..42543730 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000295890 Chr10:42481302..42481694 AGTACGATGACAGCGGGAAC Chr10:42481590..42481609 60.14 55
upstream ENSMUSE00000295879 Chr10:42503248..42503347 ACCCCAGCCAAATATTATTCC Chr10:42503318..42503338 59.07 42.86
upstream ENSMUSE00000098148 Chr10:42509106..42509220 TAGTTCTGCTTGCAGGATGG Chr10:42509111..42509130 59.02 50
upstream ENSMUSE00000098156 Chr10:42510985..42511097 GGAGCAACAGTGGCAGAAAT Chr10:42510985..42511004 60.26 50
upstream ENSMUSE00000098164 Chr10:42514581..42514642 TCTCGGAAAAATTGGGAAGA Chr10:42514597..42514616 59.62 40
upstream ENSMUSE00000295855 Chr10:42516012..42516070 GCCAGCTTGGATAGTTGACC Chr10:42516034..42516053 59.7 55
upstream ENSMUSE00000098167 Chr10:42517489..42517539 No primer for this exon
upstream ENSMUSE00000098161 Chr10:42518553..42518661 GCTCTTGGTGGTATCGGTCA Chr10:42518554..42518573 61.07 55
upstream ENSMUSE00000098155 Chr10:42521439..42521533 AGCTGGAGCTTCTGAATTTGA Chr10:42521455..42521475 59.21 42.86
upstream ENSMUSE00000098153 Chr10:42521628..42521760 AGGGAAATTGGCAGCATAAA Chr10:42521634..42521653 59.55 40
upstream ENSMUSE00000098151 Chr10:42523696..42523788 TGCTCTGCTTCAAGAAATGGT Chr10:42523724..42523744 60.01 42.86
upstream ENSMUSE00000098157 Chr10:42524882..42525036 TGCAGCTCCCTCATATTGAA Chr10:42524981..42525000 59.38 45
upstream ENSMUSE00000098158 Chr10:42526330..42526477 GGAGTTTCCCGTATGTGACC Chr10:42526439..42526458 59.26 55
upstream ENSMUSE00000098165 Chr10:42530649..42530731 AAGTTGACGAGGCAGACCAT Chr10:42530708..42530727 59.73 50
upstream ENSMUSE00000098168 Chr10:42532242..42532301 TGAAAAGGAGCAGTCCATCTG Chr10:42532250..42532270 60.38 47.62
upstream ENSMUSE00000098149 Chr10:42532471..42532644 CCTTACCTCAGGCAAAGCAG Chr10:42532589..42532608 60.01 55
upstream ENSMUSE00000098152 Chr10:42534861..42535019 TGACAAGGGCAGTGATTCTG Chr10:42534896..42534915 59.83 50
upstream ENSMUSE00000098163 Chr10:42536174..42536275 No primer for this exon
upstream ENSMUSE00000666418 Chr10:42537734..42537888 TGGAGTGGTATCCCGAACAT Chr10:42537856..42537875 60.19 50

*** Putative Vector Insertion (Chr 10: 42537889 - 42543686) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295767 Chr10:42543687..42543785 GCCACCACCACTCTTGTTTT Chr10:42543711..42543730 60.01 50
downstream ENSMUSE00000098160 Chr10:42547683..42547787 TGCGGGAAACTTCAGTTCTA Chr10:42547706..42547725 58.5 45
downstream ENSMUSE00000295749 Chr10:42548697..42552316 TGGTCCCGGAGTAACTTTTG Chr10:42549561..42549580 59.96 50
downstream ENSMUSE00000666417 Chr10:42548697..42549089 TCTATCGCTGTGTCCCACTG Chr10:42548761..42548780 59.85 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGCTGCAACAGCAAATCT Chr10:42537903..42537923 60.02 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGCTGCAACAGCAAATCT Chr10:42537903..42537923 60.02 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019802