Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36289
Trapped Gene
1700036D21Rik (ENSMUSG00000032493)
Vector Insertion
Chr 9: 110720502 - 110726801
Public Clones IST13674B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633963 (Chr9:110719593..110720501 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGGGATTGCTTGCCTTAG Chr9:110719919..110719938 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633963 (Chr9:110719593..110720501 +)
Downstram Exon
ENSMUSE00000220132 (Chr9:110726802..110726897 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGGGATTGCTTGCCTTAG Chr9:110719919..110719938 59.84 50 GTGCCGTATCATTGGGAGAT Chr9:110726829..110726848 59.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716847 Chr9:110716512..110716852 TGTCAAGACAACCGTTTCCA Chr9:110716811..110716830 60.13 45
upstream ENSMUSE00000720853 Chr9:110716512..110716852 TGTCAAGACAACCGTTTCCA Chr9:110716811..110716830 60.13 45
upstream ENSMUSE00000220120 Chr9:110717104..110717260 GGTGATTACAGCAGCCCACT Chr9:110717231..110717250 60.14 55
upstream ENSMUSE00000633965 Chr9:110717104..110717260 GGTGATTACAGCAGCCCACT Chr9:110717231..110717250 60.14 55
upstream ENSMUSE00000375508 Chr9:110717797..110718056 CCCTGTGAATTACAGCGTCA Chr9:110717944..110717963 59.72 50
upstream ENSMUSE00000633964 Chr9:110717797..110718056 CCCTGTGAATTACAGCGTCA Chr9:110717944..110717963 59.72 50
upstream ENSMUSE00000220123 Chr9:110718921..110719075 GGGGGAGTCTGTGGCTATAA Chr9:110719031..110719050 59.01 55
upstream ENSMUSE00000220147 Chr9:110719593..110719706 AATAAAACGTGGGTGCAGGT Chr9:110719626..110719645 59.36 45
upstream ENSMUSE00000633963 Chr9:110719593..110720501 CTTGGGATTGCTTGCCTTAG Chr9:110719919..110719938 59.84 50

*** Putative Vector Insertion (Chr 9: 110720502 - 110726801) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220132 Chr9:110726802..110726897 GTGCCGTATCATTGGGAGAT Chr9:110726829..110726848 59.78 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAAGGCTTAATCGCCTTGC Chr9:110720545..110720565 59.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGGCTCGTGACTGGGAAA Chr9:110720546..110720566 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032493