Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36290
Trapped Gene
Gfral (ENSMUSG00000059383)
Vector Insertion
Chr 9: 76046740 - 76053298
Public Clones IST12039A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496764 (Chr9:76053145..76053297 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGAGTATCCAGGCTTTGG Chr9:76053241..76053260 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496764 (Chr9:76053145..76053297 -)
Downstram Exon
ENSMUSE00000477006 (Chr9:76046741..76046800 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGAGTATCCAGGCTTTGG Chr9:76053241..76053260 59.69 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695556 Chr9:76061248..76061464 GTGTCAGTTCATCCGCCTTT Chr9:76061301..76061320 60.12 50
upstream ENSMUSE00000497788 Chr9:76056341..76056475 GATTGATGCAAATGGCTGTG Chr9:76056383..76056402 60.08 45
upstream ENSMUSE00000496764 Chr9:76053145..76053297 CCTGAGTATCCAGGCTTTGG Chr9:76053241..76053260 59.69 55
upstream ENSMUSE00000477006 Chr9:76046741..76046800 No primer for this exon

*** Putative Vector Insertion (Chr 9: 76046740 - 76053298) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478846 Chr9:76044835..76045165 AAGAACCGTATGGCTGCTTG Chr9:76044993..76045012 60.27 50
downstream ENSMUSE00000477810 Chr9:76041010..76041260 CATGTGCTGGAAAATCATGC Chr9:76041010..76041029 60.08 45
downstream ENSMUSE00000480604 Chr9:76015805..76015897 No primer for this exon
downstream ENSMUSE00000503085 Chr9:76014851..76014923 CACAGGTAACTGCCATGCAC Chr9:76014860..76014879 60.18 55
downstream ENSMUSE00000505901 Chr9:76011909..76012675 TTTCGATGGATGAGGGATCT Chr9:76012616..76012635 59.44 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCTGTTAGTATGGGCATGTCT Chr9:76053291..76053314 59.93 43.48 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCACGTGACTGGGAAAAC Chr9:76050232..76050252 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059383