Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36293
Trapped Gene
Polr3c (ENSMUSG00000028099)
Vector Insertion
Chr 3: 96523383 - 96526549
Public Clones IST12243B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000247775 (Chr3:96526463..96526548 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCTACTGGAGAGCCCAAG Chr3:96526496..96526515 59.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000247775 (Chr3:96526463..96526548 -)
Downstram Exon
ENSMUSE00000176078 (Chr3:96523384..96523488 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCTACTGGAGAGCCCAAG Chr3:96526496..96526515 59.45 55 AAATCCCATCGTCTGGTGAG Chr3:96523445..96523464 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000176077 Chr3:96531272..96531388 GCCTGGATGGTGCTCTACTT Chr3:96531362..96531381 59.31 55
upstream ENSMUSE00000176081 Chr3:96529757..96529922 TAATTGCCCACGACACAAAA Chr3:96529772..96529791 59.97 40
upstream ENSMUSE00000176076 Chr3:96527720..96527975 CCCCGGTACATCTACACCAC Chr3:96527839..96527858 60.11 60
upstream ENSMUSE00000176073 Chr3:96527437..96527622 TGTGCGACTGGCAGATACTC Chr3:96527563..96527582 60.02 55
upstream ENSMUSE00000247775 Chr3:96526463..96526548 ATGCTACTGGAGAGCCCAAG Chr3:96526496..96526515 59.45 55
upstream ENSMUSE00000176078 Chr3:96523384..96523488 CTCACCAGACGATGGGATTT Chr3:96523467..96523486 59.93 50

*** Putative Vector Insertion (Chr 3: 96523383 - 96526549) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176074 Chr3:96523157..96523249 GGACAGCGGCTGAGTATAGG Chr3:96523144..96523163 59.86 60
downstream ENSMUSE00000176085 Chr3:96520590..96520670 CAGCAGCGTGAGGTACTGAT Chr3:96520580..96520599 59.06 55
downstream ENSMUSE00000176084 Chr3:96520352..96520403 ACTGTCGCCAGACTTTCCAA Chr3:96520352..96520371 60.83 50
downstream ENSMUSE00000176086 Chr3:96519557..96519617 CAGTGGCTAGGGACGCTAAT Chr3:96519563..96519582 59.36 55
downstream ENSMUSE00000176075 Chr3:96519043..96519193 ATATCCTGGCACAGCGAGAC Chr3:96519146..96519165 60.25 55
downstream ENSMUSE00000176079 Chr3:96518182..96518283 TGGTCTGGCGTCTTAGGAAT Chr3:96518239..96518258 59.69 50
downstream ENSMUSE00000176072 Chr3:96518018..96518067 TTCAAACTGTCGCCGTTCTA Chr3:96518010..96518029 59.46 45
downstream ENSMUSE00000176082 Chr3:96517404..96517553 ACGTTGCGTTTCAGTGTCTC Chr3:96517388..96517407 58.94 50
downstream ENSMUSE00000176083 Chr3:96515451..96515983 TCTTCTGGGTCACTGCCTCT Chr3:96515871..96515890 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCACCGCCTCTCTATCCTT Chr3:96526497..96526517 58.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCCTCTCTATCCTCGTGAC Chr3:96526492..96526512 59.97 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028099