Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36302
Trapped Gene
4930579C12Rik (ENSMUSG00000074146)
Vector Insertion
Chr 9: 89007948 - 89020654
Public Clones IST11837F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694264 (Chr9:89020597..89020653 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694264 (Chr9:89020597..89020653 -)
Downstram Exon
ENSMUSE00000694263 (Chr9:89007949..89008209 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGCAAACAGGGACCTGAAG Chr9:89008019..89008038 60.82 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635029 Chr9:89072627..89072725 No primer for this exon
upstream ENSMUSE00000635028 Chr9:89070181..89070251 TGATGACCATCCGTGTACAAA Chr9:89070194..89070214 59.83 42.86
upstream ENSMUSE00000635027 Chr9:89069316..89069340 No primer for this exon
upstream ENSMUSE00000635026 Chr9:89066565..89066678 CCAACTTGCTCATCCACACA Chr9:89066588..89066607 60.72 50
upstream ENSMUSE00000635025 Chr9:89063760..89063824 CCTTCAGAAGAGGACGAGGA Chr9:89063785..89063804 59.53 55
upstream ENSMUSE00000635024 Chr9:89063051..89063075 No primer for this exon
upstream ENSMUSE00000635023 Chr9:89060058..89060171 ATAAGTTTCGGAGGGGCACT Chr9:89060134..89060153 59.96 50
upstream ENSMUSE00000635022 Chr9:89057700..89057770 GTTCTGATGGTGCAGCTTTG Chr9:89057739..89057758 59.44 50
upstream ENSMUSE00000635021 Chr9:89057126..89057150 No primer for this exon
upstream ENSMUSE00000635020 Chr9:89052212..89052325 CAGCACCCGTTACAACAGAA Chr9:89052213..89052232 59.76 50
upstream ENSMUSE00000635019 Chr9:89047607..89047677 GAGAGCCACCAGTAGGGATG Chr9:89047613..89047632 59.68 60
upstream ENSMUSE00000635018 Chr9:89044969..89046890 ATGCCATACATTGCCTGTGA Chr9:89045682..89045701 59.96 45
upstream ENSMUSE00000694279 Chr9:89033623..89033693 CATACCGGAGAATGCTGACA Chr9:89033673..89033692 59.67 50
upstream ENSMUSE00000694278 Chr9:89032864..89032888 No primer for this exon
upstream ENSMUSE00000694275 Chr9:89031866..89031979 CCATATGCCCTTCTGAGGTG Chr9:89031924..89031943 60.47 55
upstream ENSMUSE00000694274 Chr9:89028901..89029014 AGGGACATCCAAAGAAATGC Chr9:89028919..89028938 58.98 45
upstream ENSMUSE00000694273 Chr9:89026763..89026830 GCAGTCACAATGCACCTGAA Chr9:89026811..89026830 60.88 50
upstream ENSMUSE00000694271 Chr9:89026297..89026321 No primer for this exon
upstream ENSMUSE00000694270 Chr9:89024186..89024253 GCAGTCACAATGCACCTGAA Chr9:89024234..89024253 60.88 50
upstream ENSMUSE00000694268 Chr9:89023706..89023730 GGTTCCTCGGAAGAATCTCA Chr9:89023711..89023730 59.21 50
upstream ENSMUSE00000694267 Chr9:89022229..89022260 No primer for this exon
upstream ENSMUSE00000694266 Chr9:89021785..89021809 No primer for this exon
upstream ENSMUSE00000694265 Chr9:89021506..89021580 AATGCACAAAAAGCTGTGGA Chr9:89021517..89021536 59.32 40
upstream ENSMUSE00000694264 Chr9:89020597..89020653 No primer for this exon
upstream ENSMUSE00000694263 Chr9:89007949..89008209 GCTGCTACCTGGGCTGTTTA Chr9:89008140..89008159 60.41 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCAGTTTGGGACTGATAA Chr9:89008678..89008698 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCCTTAGACCCCTAATCC Chr9:89008605..89008626 60.28 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074146