Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36310
Trapped Gene
Slc25a43 (ENSMUSG00000037636)
Vector Insertion
Chr X: 34284014 - 34292127
Public Clones IST12044G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000355343 (ChrX:34283706..34284013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCAGGATGGCTACGTGGAG ChrX:34283733..34283752 60.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000355343 (ChrX:34283706..34284013 +)
Downstram Exon
ENSMUSE00000316538 (ChrX:34292128..34292369 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCAGGATGGCTACGTGGAG ChrX:34283733..34283752 60.68 60 CGGGTTTTGATGAGGTCTGT ChrX:34292253..34292272 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355343 ChrX:34283706..34284013 GTCAGGATGGCTACGTGGAG ChrX:34283733..34283752 60.68 60

*** Putative Vector Insertion (Chr X: 34284014 - 34292127) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316538 ChrX:34292128..34292369 CGGGTTTTGATGAGGTCTGT ChrX:34292253..34292272 59.97 50
downstream ENSMUSE00000359857 ChrX:34297763..34297935 GGGGTCCATTCCAGACTTTT ChrX:34297834..34297853 60.17 50
downstream ENSMUSE00000394777 ChrX:34315477..34315611 CCAGTACCCCTTGGGTTTTC ChrX:34315579..34315598 60.58 55
downstream ENSMUSE00000370867 ChrX:34316997..34317197 GTGCAGTTTTCTGCGTTTGA ChrX:34317179..34317198 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTAGGGTAGGATGGGAAA ChrX:34286965..34286985 59.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTAGGGTAGGATGGGAAA ChrX:34286965..34286985 59.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037636