Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36335
Trapped Gene
Birc3 (ENSMUSG00000032000)
Vector Insertion
Chr 9: 7872822 - 7873128
Public Clones IST12279H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703788 (Chr9:7872990..7873127 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGAAGTCACGCACAGAAG Chr9:7873092..7873111 59.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703788 (Chr9:7872990..7873127 -)
Downstram Exon
ENSMUSE00000215594 (Chr9:7872823..7873024 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGAAGTCACGCACAGAAG Chr9:7873092..7873111 59.62 55 TGGCGCGATACCTTTAAATC Chr9:7872890..7872909 60.06 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703788 Chr9:7872990..7873127 CAGGAAGTCACGCACAGAAG Chr9:7873092..7873111 59.62 55
upstream ENSMUSE00000215594 Chr9:7872823..7873024 AGCTGGGGACGATTTAAAGG Chr9:7872922..7872941 60.44 50
upstream ENSMUSE00000703786 Chr9:7872823..7872983 AGCTGGGGACGATTTAAAGG Chr9:7872922..7872941 60.44 50

*** Putative Vector Insertion (Chr 9: 7872822 - 7873128) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215604 Chr9:7860463..7861407 GCAAAGCAGGCCACTCTATC Chr9:7860674..7860693 59.99 55
downstream ENSMUSE00000714108 Chr9:7860463..7861407 GCAAAGCAGGCCACTCTATC Chr9:7860674..7860693 59.99 55
downstream ENSMUSE00000215609 Chr9:7860263..7860362 CCACCATCACAGCAAAAACA Chr9:7860301..7860320 60.55 45
downstream ENSMUSE00000215615 Chr9:7858701..7858779 GCTTGAACTTGGCTGACAAA Chr9:7858704..7858723 59.05 45
downstream ENSMUSE00000215595 Chr9:7857390..7857438 CTGCGTCTGCATTCTCATCT Chr9:7857371..7857390 59.14 50
downstream ENSMUSE00000703785 Chr9:7855815..7857438 CATACTTGCTGCGTCTGCAT Chr9:7857363..7857382 60.04 50
downstream ENSMUSE00000703787 Chr9:7854409..7854606 TGAACCGTCTGTCTCACCAG Chr9:7854470..7854489 59.86 55
downstream ENSMUSE00000301943 Chr9:7854367..7854606 TGAACCGTCTGTCTCACCAG Chr9:7854470..7854489 59.86 55
downstream ENSMUSE00000215608 Chr9:7850920..7851171 GGAGGCAATACAGCATTGGT Chr9:7851069..7851088 59.96 50
downstream ENSMUSE00000215611 Chr9:7849672..7849713 No primer for this exon
downstream ENSMUSE00000347462 Chr9:7848707..7849456 GATGGATACCTCTCGGTCCA Chr9:7849355..7849374 59.89 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAAGAGCCACGGAAATCT Chr9:7873076..7873096 59.43 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGAAGAGCCACGGAAATC Chr9:7873077..7873097 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032000