Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36348
Trapped Gene
Efhd1 (ENSMUSG00000026255)
Vector Insertion
Chr 1: 89186191 - 89194203
Public Clones IST11187C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000542252 (Chr1:89186043..89186190 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGACGGCTTTATTGACCT Chr1:89186056..89186075 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000542252 (Chr1:89186043..89186190 +)
Downstram Exon
ENSMUSE00000542251 (Chr1:89194204..89194338 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGACGGCTTTATTGACCT Chr1:89186056..89186075 59.96 50 ACTGTCCTCCTGCAGCTCAC Chr1:89194257..89194276 60.62 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362543 Chr1:89160938..89161329 CTCCGAACTGAACCTCAAGC Chr1:89161183..89161202 59.99 55
upstream ENSMUSE00000709822 Chr1:89160938..89161329 CTCCGAACTGAACCTCAAGC Chr1:89161183..89161202 59.99 55
upstream ENSMUSE00000542252 Chr1:89186043..89186190 AGGGACGGCTTTATTGACCT Chr1:89186056..89186075 59.96 50

*** Putative Vector Insertion (Chr 1: 89186191 - 89194203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000542251 Chr1:89194204..89194338 ACTGTCCTCCTGCAGCTCAC Chr1:89194257..89194276 60.62 60
downstream ENSMUSE00000475023 Chr1:89206236..89207413 TCACACTAGCGTGGAAGACG Chr1:89206830..89206849 60.05 55
downstream ENSMUSE00000716727 Chr1:89206236..89206421 CCAGGGTGTTAGTAAGGCACA Chr1:89206421..89206441 60.04 52.38
downstream ENSMUSE00000711748 Chr1:89206547..89207411 TCACACTAGCGTGGAAGACG Chr1:89206830..89206849 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGAGCTCAGGGTGGAAAG Chr1:89192209..89192229 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTGAGAAGATCCCTTGC Chr1:89192209..89192229 60.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026255