Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI36360
Trapped Gene
Abca7 (ENSMUSG00000035722)
Vector Insertion
Chr 10: 79467839 - 79468387
Public Clones IST12872D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000313105 (Chr10:79467699..79467838 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAACGTCTGATACGGGATG Chr10:79467774..79467793 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000313105 (Chr10:79467699..79467838 +)
Downstram Exon
ENSMUSE00000574927 (Chr10:79468388..79468525 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAACGTCTGATACGGGATG Chr10:79467774..79467793 60.34 55 CTCGTCCATGATGACCACAC Chr10:79468461..79468480 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381185 Chr10:79460360..79460425 ACCTATCGACGGAGACAACC Chr10:79460405..79460424 59.02 55
upstream ENSMUSE00000313229 Chr10:79460514..79460607 ATCCTAGTGGCTGTCCGTCA Chr10:79460559..79460578 60.68 55
upstream ENSMUSE00000313224 Chr10:79460759..79460900 AGCCTGGGGTCCTGAGTAAC Chr10:79460867..79460886 60.51 60
upstream ENSMUSE00000313216 Chr10:79460989..79461101 No primer for this exon
upstream ENSMUSE00000313204 Chr10:79461196..79461269 ACGACCACAGGAGAGTGACC Chr10:79461197..79461216 60.16 60
upstream ENSMUSE00000313199 Chr10:79461502..79461582 GGGTCAAGCCCAGGATTCTA Chr10:79461522..79461541 61.35 55
upstream ENSMUSE00000313189 Chr10:79462126..79462336 ATTGGTACGAAGCCAACCAG Chr10:79462262..79462281 59.99 50
upstream ENSMUSE00000313184 Chr10:79462426..79462565 ACTGGATGACCACCCTGTGT Chr10:79462454..79462473 60.29 55
upstream ENSMUSE00000313176 Chr10:79463457..79463573 GTGAACCAGACCTTCGAGGA Chr10:79463457..79463476 60.24 55
upstream ENSMUSE00000313168 Chr10:79463668..79463835 TGGCTGGAATCCTAGGACAA Chr10:79463807..79463826 60.59 50
upstream ENSMUSE00000313160 Chr10:79464235..79464464 GACCCATCCGAACTGTCATC Chr10:79464361..79464380 60.33 55
upstream ENSMUSE00000313152 Chr10:79464780..79464956 GTCCGTCAGCAGATCCTTTC Chr10:79464794..79464813 59.81 55
upstream ENSMUSE00000313145 Chr10:79465252..79465474 TGCGTTGCTGGTATTAGTGC Chr10:79465450..79465469 59.9 50
upstream ENSMUSE00000313139 Chr10:79465576..79465797 CGCCTATTTTGCGCTCTATC Chr10:79465716..79465735 59.97 50
upstream ENSMUSE00000313131 Chr10:79465877..79466078 GAAAGCCTGGCGCTACTAGA Chr10:79465913..79465932 59.75 55
upstream ENSMUSE00000313126 Chr10:79466542..79466652 GCCAGTATGGAATCCCTGAA Chr10:79466542..79466561 59.89 50
upstream ENSMUSE00000313120 Chr10:79467126..79467297 AAACATTTTCGTGGCTGTCC Chr10:79467185..79467204 59.98 45
upstream ENSMUSE00000313113 Chr10:79467464..79467595 GGCCATGATGTACAAACCAAC Chr10:79467516..79467536 60.11 47.62
upstream ENSMUSE00000313105 Chr10:79467699..79467838 GGAACGTCTGATACGGGATG Chr10:79467774..79467793 60.34 55

*** Putative Vector Insertion (Chr 10: 79467839 - 79468387) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000574927 Chr10:79468388..79468525 CTCGTCCATGATGACCACAC Chr10:79468461..79468480 59.96 55
downstream ENSMUSE00000313086 Chr10:79468733..79468920 GGTGACGAGGGACTGAGAAC Chr10:79468911..79468930 59.69 60
downstream ENSMUSE00000313077 Chr10:79468997..79469054 TGACTTCTTTTCCCGTCTGG Chr10:79469035..79469054 60.22 50
downstream ENSMUSE00000313071 Chr10:79469178..79469455 TGTCTGAGGTTCCTCGTGTG Chr10:79469210..79469229 59.86 55
downstream ENSMUSE00000313065 Chr10:79469631..79469667 CCTCCACCACCTTTAGGAAG Chr10:79469655..79469674 58.64 55
downstream ENSMUSE00000313057 Chr10:79469881..79469973 GTGCAGCTGCGGTCTAGAGT Chr10:79469909..79469928 60.76 60
downstream ENSMUSE00000313046 Chr10:79470069..79470196 AGCAGAAAACGCTTGTGGAG Chr10:79470165..79470184 60.57 50
downstream ENSMUSE00000313034 Chr10:79470399..79470523 TACATAGCAGGGCTGAGCTG Chr10:79470502..79470521 59.2 55
downstream ENSMUSE00000313026 Chr10:79470608..79470706 GTCCTGCATACTGGGTTCCT Chr10:79470698..79470717 59.02 55
downstream ENSMUSE00000313018 Chr10:79470890..79471177 AGGGACCGTGAAGTAGCAAG Chr10:79470938..79470957 59.35 55
downstream ENSMUSE00000313009 Chr10:79471284..79471316 CATCCACCCACTTCTTGGTC Chr10:79471312..79471331 60.36 55
downstream ENSMUSE00000313000 Chr10:79471408..79471585 GATACGGTCTAGCGCATTCC Chr10:79471534..79471553 59.7 55
downstream ENSMUSE00000312992 Chr10:79471673..79471842 CGGACTGGACCAGATGGTAG Chr10:79471773..79471792 60.52 60
downstream ENSMUSE00000574926 Chr10:79472603..79472780 GTAAAGCTGGCTGGGACAAA Chr10:79472680..79472699 60.25 50
downstream ENSMUSE00000312973 Chr10:79472896..79473011 GGCTCTCTGCTGAAAGGCTA Chr10:79472961..79472980 59.86 55
downstream ENSMUSE00000312965 Chr10:79473781..79473925 GCTGCTATTGATGCCAATGA Chr10:79473892..79473911 59.8 45
downstream ENSMUSE00000312957 Chr10:79474020..79474143 CTAAGCGCTCAAAGGCATCT Chr10:79474146..79474165 59.75 50
downstream ENSMUSE00000312947 Chr10:79474458..79474587 GGTTCTTGCCAATGATGTCC Chr10:79474511..79474530 60.33 50
downstream ENSMUSE00000312937 Chr10:79474660..79474780 CCCTGAGGACTAGCACATCC Chr10:79474772..79474791 59.68 60
downstream ENSMUSE00000312929 Chr10:79474869..79474931 ATCCACAGCTGGGTTCCTCT Chr10:79474904..79474923 61.05 55
downstream ENSMUSE00000312921 Chr10:79476057..79476163 CTGCCAGTACTGCTTCACCA Chr10:79476159..79476178 60.05 55
downstream ENSMUSE00000312913 Chr10:79476364..79476505 TCAGACTGGGGACAGTAGCC Chr10:79476423..79476442 60.26 60
downstream ENSMUSE00000312906 Chr10:79476591..79476725 GTTTGTTGCCTCCGCTGTAG Chr10:79476675..79476694 60.83 55
downstream ENSMUSE00000312896 Chr10:79476974..79477077 CTGTGCGACGTGAGCACTAC Chr10:79477080..79477099 60.68 60
downstream ENSMUSE00000312892 Chr10:79477213..79477305 GCTGAGAGCTTCCCAGACAG Chr10:79477295..79477314 60.28 60
downstream ENSMUSE00000312886 Chr10:79477692..79477932 ACTCGTGTCAGGGTGCATCT Chr10:79477859..79477878 60.75 55
downstream ENSMUSE00000365113 Chr10:79478051..79478313 TCCTCTTCCCCTTGGTCTTT Chr10:79478091..79478110 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGGGCATCAGGGACTAAT Chr10:79467874..79467894 60.29 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGACACGCCACCTCTCT Chr10:79467819..79467839 61.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035722