Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3637
Trapped Gene
2810004N23Rik (ENSMUSG00000031984)
Vector Insertion
Chr 8: 127366320 - 127384845
Public Clones BA0345 (sanger) M010C07 (ggtc) Ayu21-55 (egtc) IST12457H7 (tigm)
Private Clones OST403814 (lexicon) OST329972 (lexicon) OST220279 (lexicon) OST169561 (lexicon)
OST67841 (lexicon) OST59718 (lexicon) OST35137 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215451 (Chr8:127384846..127385171 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCCTGTACGAGGCCAGA Chr8:127385043..127385062 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215451 (Chr8:127384846..127385171 -)
Downstram Exon
ENSMUSE00000215452 (Chr8:127366263..127366319 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCCTGTACGAGGCCAGA Chr8:127385043..127385062 59.83 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000605630 Chr8:127386785..127386888 No primer for this exon
upstream ENSMUSE00000215451 Chr8:127384846..127385171 ATCTCCTGTACGAGGCCAGA Chr8:127385043..127385062 59.83 55

*** Putative Vector Insertion (Chr 8: 127366320 - 127384845) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215452 Chr8:127366263..127366319 No primer for this exon
downstream ENSMUSE00000281707 Chr8:127365587..127365682 AAGCGGTGTACTTCCAGACG Chr8:127365638..127365657 60.31 55
downstream ENSMUSE00000281683 Chr8:127365194..127365280 No primer for this exon
downstream ENSMUSE00000215450 Chr8:127364348..127364406 CTGCCCTCTCCCTTTCTTCT Chr8:127364334..127364353 59.95 55
downstream ENSMUSE00000633697 Chr8:127363257..127363866 TGGATAACAAGTGCGCTCAG Chr8:127363326..127363345 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAGCACTCTGCCACTGAGC Chr8:127375829..127375849 59.34 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTAGCACTCTGCCACTGAGC Chr8:127375829..127375849 59.34 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGAACAGGAGAGACGGAAGG Chr8:127376157..127376177 60.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGAACAGGAGAGACGGAAGG Chr8:127376157..127376177 60.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031984